This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
-rwxrwxr-x 1 ecwheele yeo-group 3.8M Apr 8 19:09 miso/K562_WT_1/A3SS/summary/A3SS.miso_summary | |
-rwxrwxr-x 1 ecwheele yeo-group 2.6M Apr 8 19:14 miso/K562_WT_1/A5SS/summary/A5SS.miso_summary | |
-rwxrwxr-x 1 ecwheele yeo-group 3.8M Apr 8 18:42 miso/K562_WT_1/AFE/summary/AFE.miso_summary | |
-rwxrwxr-x 1 ecwheele yeo-group 1.8M Apr 8 19:01 miso/K562_WT_1/ALE/summary/ALE.miso_summary | |
-rwxrwxr-x 1 ecwheele yeo-group 4.6M Apr 8 18:00 miso/K562_WT_1/MXE/summary/MXE.miso_summary | |
-rwxrwxr-x 1 ecwheele yeo-group 1.6M Apr 8 19:18 miso/K562_WT_1/RI/summary/RI.miso_summary | |
-rwxrwxr-x 1 ecwheele yeo-group 17M Apr 8 17:55 miso/K562_WT_1/SE/summary/SE.miso_summary | |
-rwxrwxr-x 1 ecwheele yeo-group 597K Apr 8 19:21 miso/K562_WT_1/TANDEMUTR/summary/TANDEMUTR.miso_summary | |
-rwxrwxr-x 1 ecwheele yeo-group 3.4M Aug 10 13:15 miso/K562_WT_2/A3SS/summary/A3SS.miso_summary | |
-rwxrwxr-x 1 ecwheele yeo-group 2.4M Aug 10 13:23 miso/K562_WT_2/A5SS/summary/A5SS.miso_summary |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
sns.set_style('white') | |
plt.figure(figsize=(10,20)) | |
ax1 = plt.subplot2grid((3,1),(0,0), title = 'Total Number of Differenitally Expressed Genes') | |
sns.barplot(x = 'count', y = 'sample', data = all_counts,hue = 'protein', palette ='deep',ax=ax1) |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
[ecwheele@tscc-login1 mds_splicing_v4]$ bash process_rnaseq.sh | |
INFO 09:21:27,273 QScriptManager - Compiling 1 QScript | |
INFO 09:21:36,790 QScriptManager - Compilation complete | |
INFO 09:21:36,952 HelpFormatter - ---------------------------------------------------------------------- | |
INFO 09:21:36,953 HelpFormatter - Queue v2.3-1155-g931452b, Compiled 2016/01/11 23:38:39 | |
INFO 09:21:36,953 HelpFormatter - Copyright (c) 2012 The Broad Institute | |
INFO 09:21:36,953 HelpFormatter - For support and documentation go to http://www.broadinstitute.org/gatk | |
INFO 09:21:36,954 HelpFormatter - Program Args: -S /home/ecwheele/gscripts/qscripts/analyze_rna_seq.scala --input manifest.txt --adapter TCGTATGCCGTCTTCTGCTTG --adapter ATCTCGTATGCCGTCTTCTGCTTG --adapter CGACAGGTTCAGAGTTCTACAGTCCGACGATC --adapter GATCGGAAGAGCACACGTCTGAACTCCAGTCAC -qsub -jobQueue home-scrm -log mds_splicing_v4.log --location /oasis/tscc/scratch/ecwheele/mds_splicing_v4/ --strict -keepIntermediates --flipped flip -run | |
INFO 09:21:36,954 HelpFor |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
(ecwheele)[ecwheele@tscc-login1 clipper]$ python setup.py install | |
Installed /home/ecwheele/software/clipper/.eggs/setuptools_git-1.1-py3.5.egg | |
running install | |
running bdist_egg | |
running egg_info | |
writing top-level names to clipper.egg-info/top_level.txt | |
writing entry points to clipper.egg-info/entry_points.txt | |
writing clipper.egg-info/PKG-INFO | |
writing requirements to clipper.egg-info/requires.txt |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
fout = open('/home/ecwheele/data/analysis/clip/region_annotations_basic/basic_first_exons.bed','w') | |
for transcript in v19_basic_db.features_of_type('transcript'): | |
reversers = transcript.strand == '-' | |
for i, exon in enumerate(v19_basic_db.children(transcript, featuretype="exon")): | |
if exon.strand == "+": | |
if exon.start == transcript.start: | |
line = '%s\t%s\t%s\t%s\t%s\t%s\n' % (exon.chrom,exon.start-1,exon.stop,exon.id,exon.score,exon.strand) | |
fout.write(line) | |
else: | |
continue |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
#!/bin/env python | |
from __future__ import print_function | |
from __future__ import division | |
from future.utils import raise_with_traceback | |
import kvector | |
from argparse import ArgumentParser | |
import pandas as pd | |
import numpy as np | |
import os |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
#!/bin/env python | |
import pybedtools | |
import subprocess | |
from argparse import ArgumentParser | |
import os | |
#Todo: Need to add a check to see if the shuffled bed file already exists | |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
outrigger index --sj-out-tab ../ep-cj-n2-ndiff-hs_S1_R1_001.polyATrim.adapterTrim.rmRep.bamSJ.out.tab --gtf /projeyeolab/genomes/hg19/gencode_v19/gencode.v19.annotation.gtf | |
2017-04-13 16:51:57 Creating folder ./outrigger_output ... | |
2017-04-13 16:51:57 Done. | |
2017-04-13 16:51:57 Creating folder ./outrigger_output/index ... | |
2017-04-13 16:51:57 Done. | |
2017-04-13 16:51:57 Creating folder ./outrigger_output/index/gtf ... | |
2017-04-13 16:51:57 Done. | |
2017-04-13 16:51:57 Creating folder ./outrigger_output/junctions ... | |
2017-04-13 16:51:57 Done. | |
2017-04-13 16:51:57 Found compiled junction reads file in ./outrigger_output/junctions/reads.csv and reading it in ... |
Loading
Sorry, something went wrong. Reload?
Sorry, we cannot display this file.
Sorry, this file is invalid so it cannot be displayed.
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
**Array Jobs on TSCC** | |
We can specify in the submission parameters that we want to submit an array job. Here is an example. Notice the -t flag, that tells TSCC to use an array job to process this. Since we have 4 commands here, we will use -t 1-4. | |
#!/bin/bash | |
#PBS -N run_homer | |
#PBS -o run_homer.sh.out | |
#PBS -e run_homer.sh.err | |
#PBS -l walltime=5:00:00 | |
#PBS -l nodes=1:ppn=1 |
OlderNewer