public
Created — forked from /Description of problem.

  • Download Gist
Description of problem.
1 2 3 4 5 6 7 8 9 10
Hi all,
 
Cluless newbie here (first time touching Perl 48 hours ago...), for which apologies.
 
I'm trying to take a genbank file (.gb), and create a FASTA file with a specific identifier line for each sequence. Specifically, I want the "host" tag as the identifier. With the help of the Bioperl beginner readme and the HOWTO's (which are great!) I've worked out how to loop through my sequences and get the 'host' tag for each one. For some reason, I get two identifier lines for each sequence. I guess the problem is in the 'for' loop--it's running the stuff below it twice, once with the actual 'host' tag data and once with...nothing? Not sure.
I think I can work out how to use s/ and a regex just to delete the second identifier line, but that feels like I'm avoiding the problem instead of fixing it. Any help appreciated!
 
Many thanks,
 
haywardjeremya@gmail.com
Examples.gb
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525 526 527 528 529 530 531 532 533 534 535 536 537 538 539 540 541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 559 560 561 562 563 564 565 566 567 568 569 570 571 572
LOCUS JQ724057 360 bp DNA linear ENV 15-MAY-2012
DEFINITION Uncultured Hebeloma clone PN_2Be_III 18S ribosomal RNA gene,
partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA
gene, and internal transcribed spacer 2, complete sequence; and 28S
ribosomal RNA gene, partial sequence.
ACCESSION JQ724057
VERSION JQ724057.1 GI:387145978
KEYWORDS ENV.
SOURCE uncultured Hebeloma
ORGANISM uncultured Hebeloma
Eukaryota; Fungi; Dikarya; Basidiomycota; Agaricomycotina;
Agaricomycetes; Agaricomycetidae; Agaricales; Cortinariaceae;
environmental samples.
REFERENCE 1 (bases 1 to 360)
AUTHORS Hrynkiewicz,K., Toljander,Y.K., Baum,C., Fransson,P.M., Taylor,A.F.
and Weih,M.
TITLE Correspondence of ectomycorrhizal diversity and colonisation of
willows (Salix spp.) grown in short rotation coppice on arable
sites and adjacent natural stands
JOURNAL Mycorrhiza (2012) In press
PUBMED 22415721
REMARK Publication Status: Available-Online prior to print
REFERENCE 2 (bases 1 to 360)
AUTHORS Hrynkiewicz,K., Toljander,Y.K., Baum,C., Fransson,P.M.A.,
Taylor,A.S.F. and Weih,M.
TITLE Direct Submission
JOURNAL Submitted (28-FEB-2012) Department of Microbiology, Institute of
General and Molecular Biology, Gagarina 9, Torun, Torun PL-87-100,
Poland
FEATURES Location/Qualifiers
source 1..360
/organism="uncultured Hebeloma"
/mol_type="genomic DNA"
/isolation_source="ectomycorrhiza of Salix fragilis"
/db_xref="taxon:210223"
/clone="PN_2Be_III"
/environmental_sample
/country="Sweden: natural/naturalized willow site NWS2"
/lat_lon="59.49 N 17.40 E"
/collection_date="Jun-2005"
/note="submitted as Helotiales sp. 1
PCR_primers=fwd_name: ITS1, rev_name: ITS4"
misc_RNA <1..>360
/note="contains 18S ribosomal RNA, internal transcribed
spacer 1, 5.8S ribosomal RNA, internal transcribed spacer
2, and 28S ribosomal RNA"
ORIGIN
1 gccccgtttt ttgaaatggg ttctattccc aaaccgtgta tacataccta tgttgctttg
61 gtaggccgcc ttttaggcgt cggctccggc tgactgcgcc tgccagagga cccaaactct
121 tttgtttagt gatgtctgag tactatataa tagttaaaac tttcaacaac ggatctcttg
181 gttctggcat cgatgaagaa cgcagcgaaa tgcgataagt aatgtgaatt gcagaattca
241 gtgaatcatc gaatctttga acgcacattg cgccccttgg tattccgagg ggcatgcctg
301 ttcgagcgtc attataacca ctcaagcctc ggcttggtct tggggttcgc ggtctcgcgg
//
 
LOCUS JQ724055 580 bp DNA linear ENV 15-MAY-2012
DEFINITION Uncultured Hebeloma clone PN_2Aa_I 18S ribosomal RNA gene, partial
sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene,
and internal transcribed spacer 2, complete sequence; and 28S
ribosomal RNA gene, partial sequence.
ACCESSION JQ724055
VERSION JQ724055.1 GI:387145976
KEYWORDS ENV.
SOURCE uncultured Hebeloma
ORGANISM uncultured Hebeloma
Eukaryota; Fungi; Dikarya; Basidiomycota; Agaricomycotina;
Agaricomycetes; Agaricomycetidae; Agaricales; Cortinariaceae;
environmental samples.
REFERENCE 1 (bases 1 to 580)
AUTHORS Hrynkiewicz,K., Toljander,Y.K., Baum,C., Fransson,P.M., Taylor,A.F.
and Weih,M.
TITLE Correspondence of ectomycorrhizal diversity and colonisation of
willows (Salix spp.) grown in short rotation coppice on arable
sites and adjacent natural stands
JOURNAL Mycorrhiza (2012) In press
PUBMED 22415721
REMARK Publication Status: Available-Online prior to print
REFERENCE 2 (bases 1 to 580)
AUTHORS Hrynkiewicz,K., Toljander,Y.K., Baum,C., Fransson,P.M.A.,
Taylor,A.S.F. and Weih,M.
TITLE Direct Submission
JOURNAL Submitted (28-FEB-2012) Department of Microbiology, Institute of
General and Molecular Biology, Gagarina 9, Torun, Torun PL-87-100,
Poland
FEATURES Location/Qualifiers
source 1..580
/organism="uncultured Hebeloma"
/mol_type="genomic DNA"
/isolation_source="ectomycorrhiza of Salix fragilis"
/db_xref="taxon:210223"
/clone="PN_2Aa_I"
/environmental_sample
/country="Sweden: natural/naturalized willow site NWS2"
/lat_lon="59.49 N 17.40 E"
/collection_date="Jun-2005"
/note="submitted as Helotiales sp. 2
PCR_primers=fwd_name: ITS1, rev_name: ITS4"
misc_RNA <1..>580
/note="contains 18S ribosomal RNA, internal transcribed
spacer 1, 5.8S ribosomal RNA, internal transcribed spacer
2, and 28S ribosomal RNA"
ORIGIN
1 tcttggtcat ttagaggaag taaaagtcgt aacaaggttt ccgtaggtga acctgcggaa
61 ggatcattac agagttcatg cccttacggg tagatctccc accctttgag tactatactt
121 ttgttgcttt ggcaggccgc ttcggctacc ggcttcggct ggtgagtgcc tgccagagga
181 ccccaaactc tgaattatag tgtcgtctga gaactatata atagttaaaa ctttcaacaa
241 cggatctctt ggttctggca tcgatgaaga acgcagcgaa atgcgataag taatgtgaat
301 tgcagaattc agtgaatcat cgaatctttg aacgcacatt gcgccccttg gtattccggg
361 gggcatgcct gttcgagcgt cattataacc ctcaagccta gcttggtgtt ggagcctgcc
421 tctgggcagc tcttaaaatc agtggcggtg ccgtctggct ctaagcgtag taattcttct
481 cgctacagag tcccggcggt tgcttgccaa caaccccaaa ttttctatgg ttgacctcgg
541 atcaggtagg gatacccgct gaacttaagc atatcaataa
//
 
LOCUS JQ724053 517 bp DNA linear ENV 15-MAY-2012
DEFINITION Uncultured Hebeloma clone PN_1Ae_V 18S ribosomal RNA gene, partial
sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene,
and internal transcribed spacer 2, complete sequence; and 28S
ribosomal RNA gene, partial sequence.
ACCESSION JQ724053
VERSION JQ724053.1 GI:387145974
KEYWORDS ENV.
SOURCE uncultured Hebeloma
ORGANISM uncultured Hebeloma
Eukaryota; Fungi; Dikarya; Basidiomycota; Agaricomycotina;
Agaricomycetes; Agaricomycetidae; Agaricales; Cortinariaceae;
environmental samples.
REFERENCE 1 (bases 1 to 517)
AUTHORS Hrynkiewicz,K., Toljander,Y.K., Baum,C., Fransson,P.M., Taylor,A.F.
and Weih,M.
TITLE Correspondence of ectomycorrhizal diversity and colonisation of
willows (Salix spp.) grown in short rotation coppice on arable
sites and adjacent natural stands
JOURNAL Mycorrhiza (2012) In press
PUBMED 22415721
REMARK Publication Status: Available-Online prior to print
REFERENCE 2 (bases 1 to 517)
AUTHORS Hrynkiewicz,K., Toljander,Y.K., Baum,C., Fransson,P.M.A.,
Taylor,A.S.F. and Weih,M.
TITLE Direct Submission
JOURNAL Submitted (28-FEB-2012) Department of Microbiology, Institute of
General and Molecular Biology, Gagarina 9, Torun, Torun PL-87-100,
Poland
FEATURES Location/Qualifiers
source 1..517
/organism="uncultured Hebeloma"
/mol_type="genomic DNA"
/isolation_source="ectomycorrhiza of Salix fragilis"
/db_xref="taxon:210223"
/clone="PN_1Ae_V"
/environmental_sample
/country="Sweden: natural/naturalized willow site NWS2"
/lat_lon="59.49 N 17.40 E"
/collection_date="Jun-2005"
/note="submitted as Helotiales sp. 1
PCR_primers=fwd_name: ITS1, rev_name: ITS4"
misc_RNA <1..>517
/note="contains 18S ribosomal RNA, internal transcribed
spacer 1, 5.8S ribosomal RNA, internal transcribed spacer
2, and 28S ribosomal RNA"
ORIGIN
1 tggtaagaga gtgcaggatg aacaatggac gatccgcagc gaagacccta ccggcgagag
61 cccacgggta ccgttcacag actaagtgat tgtgggcggg gcgtcaggcc ctgtctaaga
121 tatagtcggt ctctgctcga aaggtcagag cctagcgcgt ccgtaggtga acctgcggaa
181 ggatcattaa agaatcgccc cgttttttga aatgggttct attcccaaac cgtgtataca
241 tacctttgtt gctttggtag gccgccttct aggcgtcggc tccggctgac tgcgcctgcc
301 agaggaccca aactcgtttg tttagtgatg tctgagtact atataatagt taaaactttc
361 aacaacggat ctcttggttc tggcatcgat gaagaacgca gcgaaatgcg ataagtaatg
421 tgaattgcag aattcagtga atcatcgaat ctttgaacgc acattgcgcc ccttggtatt
481 ccgaggggca tgcctgttcg agcgtcatta caaccac
//
 
LOCUS JQ724051 685 bp DNA linear ENV 15-MAY-2012
DEFINITION Uncultured Tomentella clone PN_3Aa_I 18S ribosomal RNA gene,
partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA
gene, and internal transcribed spacer 2, complete sequence; and 28S
ribosomal RNA gene, partial sequence.
ACCESSION JQ724051
VERSION JQ724051.1 GI:387145972
KEYWORDS ENV.
SOURCE uncultured Tomentella
ORGANISM uncultured Tomentella
Eukaryota; Fungi; Dikarya; Basidiomycota; Agaricomycotina;
Agaricomycetes; Thelephorales; Thelephoraceae; environmental
samples.
REFERENCE 1 (bases 1 to 685)
AUTHORS Hrynkiewicz,K., Toljander,Y.K., Baum,C., Fransson,P.M., Taylor,A.F.
and Weih,M.
TITLE Correspondence of ectomycorrhizal diversity and colonisation of
willows (Salix spp.) grown in short rotation coppice on arable
sites and adjacent natural stands
JOURNAL Mycorrhiza (2012) In press
PUBMED 22415721
REMARK Publication Status: Available-Online prior to print
REFERENCE 2 (bases 1 to 685)
AUTHORS Hrynkiewicz,K., Toljander,Y.K., Baum,C., Fransson,P.M.A.,
Taylor,A.S.F. and Weih,M.
TITLE Direct Submission
JOURNAL Submitted (28-FEB-2012) Department of Microbiology, Institute of
General and Molecular Biology, Gagarina 9, Torun, Torun PL-87-100,
Poland
FEATURES Location/Qualifiers
source 1..685
/organism="uncultured Tomentella"
/mol_type="genomic DNA"
/isolation_source="ectomycorrhiza of Salix fragilis"
/db_xref="taxon:246176"
/clone="PN_3Aa_I"
/environmental_sample
/country="Sweden: natural/naturalized willow site NWS2"
/lat_lon="59.49 N 17.40 E"
/collection_date="Jun-2005"
/note="submitted as Tomentella cf. coerulea
PCR_primers=fwd_name: ITS1, rev_name: ITS4"
misc_RNA <1..>685
/note="contains 18S ribosomal RNA, internal transcribed
spacer 1, 5.8S ribosomal RNA, internal transcribed spacer
2, and 28S ribosomal RNA"
ORIGIN
1 agaggaagta aaagtcgtaa caaggtttcc gtaggtgaac ctgcggaagg atcattactg
61 aactgttgac acgagttgtt gctggtcctt gaaagggggc atgtgcacac tctgtttaca
121 catccactca cacctgtgca ccctctgtag ttctgtggca ttggggactc tgtcctcttg
181 ctgtggtcct acgtctttac acacacacac cgtaatacag tctcatggaa tgtatgtcgc
241 gtttaacgca atacaataca actttcagca acggatctct tggctctcgc atcgatgaag
301 aacgcagcga aatgcgataa gtaatgtgaa ttgcagaatt cagtgaatca tcgaatcttt
361 gaacgcacct tgcgcccttt ggctattccg aagggcatgc ctgtttgagt atcatgaaca
421 cctcaactct catggcctgc catgatgagc ttggattttg ggggtcttgc tggcctaacc
481 gtcggctcct ctcaaatgaa tcagcttgcc agtgtttggt ggcatcacag gtgtgataac
541 tatctacgct tgtggttctc caccaggtaa ccttcagcaa tggaggttcg ctggagctca
601 cagatgtctc tccccaggga cagctttttg aacgtttgat ctcaaatcag gtaggactac
661 ccgctgaact taagcatatc aataa
//
 
LOCUS JQ724047 618 bp DNA linear ENV 15-MAY-2012
DEFINITION Uncultured Tomentella clone PN_1Ab_I 18S ribosomal RNA gene,
partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA
gene, and internal transcribed spacer 2, complete sequence; and 28S
ribosomal RNA gene, partial sequence.
ACCESSION JQ724047
VERSION JQ724047.1 GI:387145968
KEYWORDS ENV.
SOURCE uncultured Tomentella
ORGANISM uncultured Tomentella
Eukaryota; Fungi; Dikarya; Basidiomycota; Agaricomycotina;
Agaricomycetes; Thelephorales; Thelephoraceae; environmental
samples.
REFERENCE 1 (bases 1 to 618)
AUTHORS Hrynkiewicz,K., Toljander,Y.K., Baum,C., Fransson,P.M., Taylor,A.F.
and Weih,M.
TITLE Correspondence of ectomycorrhizal diversity and colonisation of
willows (Salix spp.) grown in short rotation coppice on arable
sites and adjacent natural stands
JOURNAL Mycorrhiza (2012) In press
PUBMED 22415721
REMARK Publication Status: Available-Online prior to print
REFERENCE 2 (bases 1 to 618)
AUTHORS Hrynkiewicz,K., Toljander,Y.K., Baum,C., Fransson,P.M.A.,
Taylor,A.S.F. and Weih,M.
TITLE Direct Submission
JOURNAL Submitted (28-FEB-2012) Department of Microbiology, Institute of
General and Molecular Biology, Gagarina 9, Torun, Torun PL-87-100,
Poland
FEATURES Location/Qualifiers
source 1..618
/organism="uncultured Tomentella"
/mol_type="genomic DNA"
/isolation_source="ectomycorrhiza of Salix fragilis"
/db_xref="taxon:246176"
/clone="PN_1Ab_I"
/environmental_sample
/country="Sweden: natural/naturalized willow site NWS2"
/lat_lon="59.49 N 17.40 E"
/collection_date="Jun-2005"
/note="submitted as Tomentella sp. 2
PCR_primers=fwd_name: ITS1, rev_name: ITS4"
misc_RNA <1..>618
/note="contains 18S ribosomal RNA, internal transcribed
spacer 1, 5.8S ribosomal RNA, internal transcribed spacer
2, and 28S ribosomal RNA"
ORIGIN
1 acacgagttg ttgctggtcc tcaaacgggg gcatgtgcac gctctgttca cacatccact
61 cacacctgtg caccctctgt agttctatgg tctggggggg ctctgccctc tcgccgtggt
121 tctatgtctt tacacacgca ctgtaataaa gtttcatgga atgcatgacg cgtttaacgc
181 aatacaatac aactttcagc aacggatctc ttggctctcg catcgatgaa gaacgcagcg
241 aaatgcgata agtaatgtga attgcagaat tcagtgaatc atcgaatctt tgaacgcacc
301 ttgcgccctt tggtattcca gagggcatgc ctgtttgagt atcatgaaca cctcaactct
361 cacggtccgc cgtgatgagc ttggactttg ggggtcttgc tggcctgcgg gtcggctcct
421 ctcaaatgaa tcagcttgcc agtgtttggt ggcatcacgg gtgtgataac tatctacgct
481 tgtggttttc caccaggtaa ccttcagcaa tggaggttcg ctggggctca caaatgtctc
541 tcctcggtga ggacaacttc ttgaatgttt gatctcaaat caggtagggc tacccgctga
601 acttaagcat atcaataa
//
 
LOCUS JQ982978 478 bp DNA linear ENV 06-MAY-2012
DEFINITION Uncultured Thelephora clone 2 18S ribosomal RNA gene, partial
sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene,
and internal transcribed spacer 2, complete sequence; and 28S
ribosomal RNA gene, partial sequence.
ACCESSION JQ982978
VERSION JQ982978.1 GI:385845718
KEYWORDS ENV.
SOURCE uncultured Thelephora
ORGANISM uncultured Thelephora
Eukaryota; Fungi; Dikarya; Basidiomycota; Agaricomycotina;
Agaricomycetes; Thelephorales; Thelephoraceae; environmental
samples.
REFERENCE 1 (bases 1 to 478)
AUTHORS Polle,A.
TITLE Ectomycorrhiza as a link between trees (Fagus sylvatica) and the
belowground food web
JOURNAL Unpublished
REFERENCE 2 (bases 1 to 478)
AUTHORS Polle,A.
TITLE Direct Submission
JOURNAL Submitted (21-MAR-2012) Forest Botany and Tree Physiology,
Buesgen-Institut, Buesgenweg 2, Goettingen 37077, Germany
FEATURES Location/Qualifiers
source 1..478
/organism="uncultured Thelephora"
/mol_type="genomic DNA"
/isolation_source="mycorrhizal root tip"
/host="Fagus sylvatica"
/db_xref="taxon:526474"
/clone="2"
/environmental_sample
/country="Germany"
/collection_date="Sep-2009"
/collected_by="K. Valtanen"
/identified_by="K. Valtanen"
/PCR_primers="fwd_name: ITS1F, fwd_seq:
cttggtcatttagaggaagtaa, rev_name: ITS4, rev_seq:
tcctccgcttattgatatgc"
/note="submitted as 'uncultured ectomycorrhiza
[Thelephora]'"
misc_RNA <1..>478
/note="contains internal transcribed spacer 1, 5.8S
ribosomal RNA, and internal transcribed spacer 2; may also
contain18S ribosomal RNA and 28S ribosomal RNA"
ORIGIN
1 agggggcatg tgcacgctct gttcacacat ccactcacac ctgtgcaccc tctgtagttc
61 tatggtctgg aggatgcacc gtcttccttc tgtagttcta cgtctttaca catacgccct
121 agtgaagttt tatggaatgt gtgccgcgtc taacgcaata caatacaact ttcagcaacg
181 gatctcttgg ctctcgcatc gatgaagaac gcagcgaaat gcgataagta atgtgaattg
241 cagaattcag tgaatcatcg aatctttgaa cgcaccttgc gccccttgga tattctgagg
301 ggcatgcctg tttgagtatc atgaacacct caactcctca tggtttgccg tgatgagctt
361 ggacttttgg aggttttgct ggccctgctg tcggctcctc tcaaatggat cagcttgcca
421 gtgtttggtg gcgtcatggg tgtgataact atctacgctt gtggccgtct gccaggta
//
 
LOCUS JQ982976 546 bp DNA linear ENV 06-MAY-2012
DEFINITION Uncultured Peziza clone 6.1 18S ribosomal RNA gene, partial
sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene,
and internal transcribed spacer 2, complete sequence; and 28S
ribosomal RNA gene, partial sequence.
ACCESSION JQ982976
VERSION JQ982976.1 GI:385845716
KEYWORDS ENV.
SOURCE uncultured Peziza
ORGANISM uncultured Peziza
Eukaryota; Fungi; Dikarya; Ascomycota; Pezizomycotina;
Pezizomycetes; Pezizales; Pezizaceae; environmental samples.
REFERENCE 1 (bases 1 to 546)
AUTHORS Polle,A.
TITLE Ectomycorrhiza as a link between trees (Fagus sylvatica) and the
belowground food web
JOURNAL Unpublished
REFERENCE 2 (bases 1 to 546)
AUTHORS Polle,A.
TITLE Direct Submission
JOURNAL Submitted (21-MAR-2012) Forest Botany and Tree Physiology,
Buesgen-Institut, Buesgenweg 2, Goettingen 37077, Germany
FEATURES Location/Qualifiers
source 1..546
/organism="uncultured Peziza"
/mol_type="genomic DNA"
/isolation_source="mycorrhizal root tip"
/host="Fagus sylvatica"
/db_xref="taxon:522718"
/clone="6.1"
/environmental_sample
/country="Germany"
/collection_date="Sep-2009"
/collected_by="K. Valtanen"
/identified_by="K. Valtanen"
/PCR_primers="fwd_name: ITS1F, fwd_seq:
cttggtcatttagaggaagtaa, rev_name: ITS4, rev_seq:
tcctccgcttattgatatgc"
/note="submitted as 'uncultured ectomycorrhiza [Peziza
succosa]'"
misc_RNA <1..>546
/note="contains internal transcribed spacer 1, 5.8S
ribosomal RNA, and internal transcribed spacer 2; may also
contain18S ribosomal RNA and 28S ribosomal RNA"
ORIGIN
1 aggtgaacct gcggaaggat cattattgat agtttgtatt atcaaaaacc cctttgttta
61 tcatttacca tgttgcttcc attggacaga ccggcaattg tgtatacaaa aagttggtcc
121 tctagttttg tgtttatttg gcactagcta gggagctgcc agtggataga atccaaataa
181 aaaattcgtg aagaaatata tattgtctga tttattagta taaaaaaaat aaaactttca
241 acaacggatc tctaggctct tgcatcgatg aagaacgcag tgaaatgcga taagtaatgt
301 gaattgcaga atctcgtgaa tcatcgaatc tttgaacgca cattgcgccc tatggaattc
361 tgtagggcat gcctgtctga gcgtcagcag ccaaaaaaat ccaaatcttt gtagataaag
421 atttggattt ggttaagaga tgtaatctgt gtaagaaccg gttactcttt tgaaatttaa
481 aggcagtatt gatcaatcca actgtaaacg tgataaaaca tttcgttttt attgttcgga
541 atgagc
//
 
LOCUS JQ982974 394 bp DNA linear ENV 06-MAY-2012
DEFINITION Uncultured Lactarius clone MT9 18S ribosomal RNA gene, partial
sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene,
and internal transcribed spacer 2, complete sequence; and 28S
ribosomal RNA gene, partial sequence.
ACCESSION JQ982974
VERSION JQ982974.1 GI:385845714
KEYWORDS ENV.
SOURCE uncultured Lactarius
ORGANISM uncultured Lactarius
Eukaryota; Fungi; Dikarya; Basidiomycota; Agaricomycotina;
Agaricomycetes; Russulales; Russulaceae; environmental samples.
REFERENCE 1 (bases 1 to 394)
AUTHORS Polle,A.
TITLE Ectomycorrhiza as a link between trees (Fagus sylvatica) and the
belowground food web
JOURNAL Unpublished
REFERENCE 2 (bases 1 to 394)
AUTHORS Polle,A.
TITLE Direct Submission
JOURNAL Submitted (21-MAR-2012) Forest Botany and Tree Physiology,
Buesgen-Institut, Buesgenweg 2, Goettingen 37077, Germany
FEATURES Location/Qualifiers
source 1..394
/organism="uncultured Lactarius"
/mol_type="genomic DNA"
/isolation_source="mycorrhizal root tip"
/host="Fagus sylvatica"
/db_xref="taxon:228206"
/clone="MT9"
/environmental_sample
/country="Germany"
/collection_date="Sep-2009"
/collected_by="K. Valtanen"
/identified_by="K. Valtanen"
/PCR_primers="fwd_name: ITS1F, fwd_seq:
cttggtcatttagaggaagtaa, rev_name: ITS4, rev_seq:
tcctccgcttattgatatgc"
/note="submitted as 'uncultured ectomycorrhiza [Lactarius
subdulcis]'"
misc_RNA <1..>394
/note="contains internal transcribed spacer 1, 5.8S
ribosomal RNA, and internal transcribed spacer 2; may also
contain18S ribosomal RNA and 28S ribosomal RNA"
ORIGIN
1 ttgggatcat ctcggagggg gctcgcgttt tcacacaaac ccccctttta aaagtgtaga
61 atgacctcat ttatgcgcta acccgcaatc aatacaactt tcaacaacgg atctcttggc
121 tctcgcatcg atgaagaacg cagcgaaatg cgatacgtaa tgtgaattgc agaattcagt
181 gaatcatcga atctttgaac gcaccttgcg ccccttggta ttccgagggg cacacccgtt
241 tgagtgtcgt gaaaacctca acctccttgg tttcttctgg agaccaaagc aggcttggac
301 tttggaggcc tttgctggca cctctctttt gaaggccagc tcctcttaaa caaattagca
361 gggtcctctt tgccgatcct cgacgtgtga taag
//
 
LOCUS JQ982972 481 bp DNA linear ENV 06-MAY-2012
DEFINITION Uncultured Clavulina clone MT3.2 18S ribosomal RNA gene, partial
sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene,
and internal transcribed spacer 2, complete sequence; and 28S
ribosomal RNA gene, partial sequence.
ACCESSION JQ982972
VERSION JQ982972.1 GI:385845712
KEYWORDS ENV.
SOURCE uncultured Clavulina
ORGANISM uncultured Clavulina
Eukaryota; Fungi; Dikarya; Basidiomycota; Agaricomycotina;
Agaricomycetes; Cantharellales; Clavulinaceae; environmental
samples.
REFERENCE 1 (bases 1 to 481)
AUTHORS Polle,A.
TITLE Ectomycorrhiza as a link between trees (Fagus sylvatica) and the
belowground food web
JOURNAL Unpublished
REFERENCE 2 (bases 1 to 481)
AUTHORS Polle,A.
TITLE Direct Submission
JOURNAL Submitted (21-MAR-2012) Forest Botany and Tree Physiology,
Buesgen-Institut, Buesgenweg 2, Goettingen 37077, Germany
FEATURES Location/Qualifiers
source 1..481
/organism="uncultured Clavulina"
/mol_type="genomic DNA"
/isolation_source="mycorrhizal root tip"
/host="Fagus sylvatica"
/db_xref="taxon:228201"
/clone="MT3.2"
/environmental_sample
/country="Germany"
/collection_date="Sep-2009"
/collected_by="K. Valtanen"
/identified_by="K. Valtanen"
/PCR_primers="fwd_name: ITS1F, fwd_seq:
cttggtcatttagaggaagtaa, rev_name: ITS4, rev_seq:
tcctccgcttattgatatgc"
/note="submitted as 'uncultured ectomycorrhiza [Clavulina
cf.cinerea]'"
misc_RNA <1..>481
/note="contains internal transcribed spacer 1, 5.8S
ribosomal RNA, and internal transcribed spacer 2; may also
contain18S ribosomal RNA and 28S ribosomal RNA"
ORIGIN
1 ggatgcatgt gcttgcccta acaatcatct tccaaacacc tgtgcacatt tttgagggag
61 tttcgagttt tattgccgtt tttggtgatt ttcttgtatt cccttgaatt attatacgct
121 gttaacaatg atgaacgtgc tctgtgccgc aaggccatta atataataca acttttaaca
181 acggatctct tggctctcgc atcgatgaag aacgcagcga aatgcgataa gtaatgtgaa
241 ttgcagaatt cagtgaatca tcgaatcttt gaacgcacct tgcgctccct ggtattccgg
301 ggagcacgcc tgttcgagtg tcgcgaaatt tctcaagctt ggatggcctt tttgtctgtc
361 cttagccttg gttgttgggc tttgccgtgt cctttgttgg gacggctggc cttaaaagca
421 ttagctgatc ctcgtgtggc actggttcta ctcagcgtga taacagtctg atcgctgagg
481 a
//
 
LOCUS JQ982970 428 bp DNA linear ENV 06-MAY-2012
DEFINITION Uncultured Clavulina clone MT3.1 18S ribosomal RNA gene, partial
sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene,
and internal transcribed spacer 2, complete sequence; and 28S
ribosomal RNA gene, partial sequence.
ACCESSION JQ982970
VERSION JQ982970.1 GI:385845710
KEYWORDS ENV.
SOURCE uncultured Clavulina
ORGANISM uncultured Clavulina
Eukaryota; Fungi; Dikarya; Basidiomycota; Agaricomycotina;
Agaricomycetes; Cantharellales; Clavulinaceae; environmental
samples.
REFERENCE 1 (bases 1 to 428)
AUTHORS Polle,A.
TITLE Ectomycorrhiza as a link between trees (Fagus sylvatica) and the
belowground food web
JOURNAL Unpublished
REFERENCE 2 (bases 1 to 428)
AUTHORS Polle,A.
TITLE Direct Submission
JOURNAL Submitted (21-MAR-2012) Forest Botany and Tree Physiology,
Buesgen-Institut, Buesgenweg 2, Goettingen 37077, Germany
FEATURES Location/Qualifiers
source 1..428
/organism="uncultured Clavulina"
/mol_type="genomic DNA"
/isolation_source="mycorrhizal root tip"
/host="Fagus sylvatica"
/db_xref="taxon:228201"
/clone="MT3.1"
/environmental_sample
/country="Germany"
/collection_date="Sep-2009"
/collected_by="K. Valtanen"
/identified_by="K. Valtanen"
/PCR_primers="fwd_name: ITS1F, fwd_seq:
cttggtcatttagaggaagtaa, rev_name: ITS4, rev_seq:
tcctccgcttattgatatgc"
/note="submitted as 'uncultured ectomycorrhiza [Clavulina
cf.cinerea]'"
misc_RNA <1..>428
/note="contains internal transcribed spacer 1, 5.8S
ribosomal RNA, and internal transcribed spacer 2; may also
contain18S ribosomal RNA and 28S ribosomal RNA"
ORIGIN
1 gagggagttt cgagttttat tgccgttttt ggtgattttc ttgtattccc ttgaattatt
61 atacgctgtt aacaatgatg aacgtgctct gtgccgcaag gccattaata taatacaact
121 tttaacaacg gatctcttgg ctctcgcatc gatgaagaac gcagcgaaat gcgataagta
181 atgtgaattg cagaattcag tgaatcatcg aatctttgaa cgcaccttgc gctccctggt
241 attccgggga gcacgcctgt tcgagtgtcg cgaaatttct caagcttgga tggccttttt
301 gtctgtcctt agccttggtt gttgggcttt gccgtgtcct ttgttgggac ggctggcctt
361 aaaagcatta gctgatcctc gtgtggcact ggttctactc agcgtgataa cagtctgatc
421 gctgagga
//
Expected output
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21
perl HostGrabber.pl sequence.gb
>Unknown
GCCCCGTTTTTTGAAATGGGTTCTATTCCCAAACCGTGTATACATACCTATGTTGCTTTGGTAGGCCGCCTTTTAGGCGTCGGCTCCGGCTGACTGCGCCTGCCAGAGGACCCAAACTCTTTTGTTTAGTGATGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTATAACCACTCAAGCCTCGGCTTGGTCTTGGGGTTCGCGGTCTCGCGG
>Unknown
TCTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACAGAGTTCATGCCCTTACGGGTAGATCTCCCACCCTTTGAGTACTATACTTTTGTTGCTTTGGCAGGCCGCTTCGGCTACCGGCTTCGGCTGGTGAGTGCCTGCCAGAGGACCCCAAACTCTGAATTATAGTGTCGTCTGAGAACTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTATAACCCTCAAGCCTAGCTTGGTGTTGGAGCCTGCCTCTGGGCAGCTCTTAAAATCAGTGGCGGTGCCGTCTGGCTCTAAGCGTAGTAATTCTTCTCGCTACAGAGTCCCGGCGGTTGCTTGCCAACAACCCCAAATTTTCTATGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAA
>Unknown
TGGTAAGAGAGTGCAGGATGAACAATGGACGATCCGCAGCGAAGACCCTACCGGCGAGAGCCCACGGGTACCGTTCACAGACTAAGTGATTGTGGGCGGGGCGTCAGGCCCTGTCTAAGATATAGTCGGTCTCTGCTCGAAAGGTCAGAGCCTAGCGCGTCCGTAGGTGAACCTGCGGAAGGATCATTAAAGAATCGCCCCGTTTTTTGAAATGGGTTCTATTCCCAAACCGTGTATACATACCTTTGTTGCTTTGGTAGGCCGCCTTCTAGGCGTCGGCTCCGGCTGACTGCGCCTGCCAGAGGACCCAAACTCGTTTGTTTAGTGATGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTACAACCAC
>Unknown
AGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACTGAACTGTTGACACGAGTTGTTGCTGGTCCTTGAAAGGGGGCATGTGCACACTCTGTTTACACATCCACTCACACCTGTGCACCCTCTGTAGTTCTGTGGCATTGGGGACTCTGTCCTCTTGCTGTGGTCCTACGTCTTTACACACACACACCGTAATACAGTCTCATGGAATGTATGTCGCGTTTAACGCAATACAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGCTATTCCGAAGGGCATGCCTGTTTGAGTATCATGAACACCTCAACTCTCATGGCCTGCCATGATGAGCTTGGATTTTGGGGGTCTTGCTGGCCTAACCGTCGGCTCCTCTCAAATGAATCAGCTTGCCAGTGTTTGGTGGCATCACAGGTGTGATAACTATCTACGCTTGTGGTTCTCCACCAGGTAACCTTCAGCAATGGAGGTTCGCTGGAGCTCACAGATGTCTCTCCCCAGGGACAGCTTTTTGAACGTTTGATCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAA
>Unknown
ACACGAGTTGTTGCTGGTCCTCAAACGGGGGCATGTGCACGCTCTGTTCACACATCCACTCACACCTGTGCACCCTCTGTAGTTCTATGGTCTGGGGGGGCTCTGCCCTCTCGCCGTGGTTCTATGTCTTTACACACGCACTGTAATAAAGTTTCATGGAATGCATGACGCGTTTAACGCAATACAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGTATTCCAGAGGGCATGCCTGTTTGAGTATCATGAACACCTCAACTCTCACGGTCCGCCGTGATGAGCTTGGACTTTGGGGGTCTTGCTGGCCTGCGGGTCGGCTCCTCTCAAATGAATCAGCTTGCCAGTGTTTGGTGGCATCACGGGTGTGATAACTATCTACGCTTGTGGTTTTCCACCAGGTAACCTTCAGCAATGGAGGTTCGCTGGGGCTCACAAATGTCTCTCCTCGGTGAGGACAACTTCTTGAATGTTTGATCTCAAATCAGGTAGGGCTACCCGCTGAACTTAAGCATATCAATAA
>Fagus sylvatica
AGGGGGCATGTGCACGCTCTGTTCACACATCCACTCACACCTGTGCACCCTCTGTAGTTCTATGGTCTGGAGGATGCACCGTCTTCCTTCTGTAGTTCTACGTCTTTACACATACGCCCTAGTGAAGTTTTATGGAATGTGTGCCGCGTCTAACGCAATACAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGATATTCTGAGGGGCATGCCTGTTTGAGTATCATGAACACCTCAACTCCTCATGGTTTGCCGTGATGAGCTTGGACTTTTGGAGGTTTTGCTGGCCCTGCTGTCGGCTCCTCTCAAATGGATCAGCTTGCCAGTGTTTGGTGGCGTCATGGGTGTGATAACTATCTACGCTTGTGGCCGTCTGCCAGGTA
>Fagus sylvatica
AGGTGAACCTGCGGAAGGATCATTATTGATAGTTTGTATTATCAAAAACCCCTTTGTTTATCATTTACCATGTTGCTTCCATTGGACAGACCGGCAATTGTGTATACAAAAAGTTGGTCCTCTAGTTTTGTGTTTATTTGGCACTAGCTAGGGAGCTGCCAGTGGATAGAATCCAAATAAAAAATTCGTGAAGAAATATATATTGTCTGATTTATTAGTATAAAAAAAATAAAACTTTCAACAACGGATCTCTAGGCTCTTGCATCGATGAAGAACGCAGTGAAATGCGATAAGTAATGTGAATTGCAGAATCTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTATGGAATTCTGTAGGGCATGCCTGTCTGAGCGTCAGCAGCCAAAAAAATCCAAATCTTTGTAGATAAAGATTTGGATTTGGTTAAGAGATGTAATCTGTGTAAGAACCGGTTACTCTTTTGAAATTTAAAGGCAGTATTGATCAATCCAACTGTAAACGTGATAAAACATTTCGTTTTTATTGTTCGGAATGAGC
>Fagus sylvatica
TTGGGATCATCTCGGAGGGGGCTCGCGTTTTCACACAAACCCCCCTTTTAAAAGTGTAGAATGACCTCATTTATGCGCTAACCCGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAAACCTCAACCTCCTTGGTTTCTTCTGGAGACCAAAGCAGGCTTGGACTTTGGAGGCCTTTGCTGGCACCTCTCTTTTGAAGGCCAGCTCCTCTTAAACAAATTAGCAGGGTCCTCTTTGCCGATCCTCGACGTGTGATAAG
>Fagus sylvatica
GGATGCATGTGCTTGCCCTAACAATCATCTTCCAAACACCTGTGCACATTTTTGAGGGAGTTTCGAGTTTTATTGCCGTTTTTGGTGATTTTCTTGTATTCCCTTGAATTATTATACGCTGTTAACAATGATGAACGTGCTCTGTGCCGCAAGGCCATTAATATAATACAACTTTTAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCCTGGTATTCCGGGGAGCACGCCTGTTCGAGTGTCGCGAAATTTCTCAAGCTTGGATGGCCTTTTTGTCTGTCCTTAGCCTTGGTTGTTGGGCTTTGCCGTGTCCTTTGTTGGGACGGCTGGCCTTAAAAGCATTAGCTGATCCTCGTGTGGCACTGGTTCTACTCAGCGTGATAACAGTCTGATCGCTGAGGA
>Fagus sylvatica
GAGGGAGTTTCGAGTTTTATTGCCGTTTTTGGTGATTTTCTTGTATTCCCTTGAATTATTATACGCTGTTAACAATGATGAACGTGCTCTGTGCCGCAAGGCCATTAATATAATACAACTTTTAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCCTGGTATTCCGGGGAGCACGCCTGTTCGAGTGTCGCGAAATTTCTCAAGCTTGGATGGCCTTTTTGTCTGTCCTTAGCCTTGGTTGTTGGGCTTTGCCGTGTCCTTTGTTGGGACGGCTGGCCTTAAAAGCATTAGCTGATCCTCGTGTGGCACTGGTTCTACTCAGCGTGATAACAGTCTGATCGCTGAGGA
HostFastaMaker.pl
Perl
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28
 
#!/usr/bin/perl -w
use strict;
use Bio::Seq;
use Bio::SeqIO;
 
my $input_file = shift;
my $feat_object;
my $seq_in = Bio::SeqIO->new(
-format => 'genbank',
-file => $input_file,
);
my $out = Bio::SeqIO->new(-format => 'fasta', -fh => \*STDOUT);
#procedural
while(my $seq = $seq_in->next_seq ) { #for everything in the original input file
# print 'Loading sequence: ', $seq->accession_number,"\n";
my $host_name = 'Unknown';
for my $feat_object ($seq->get_SeqFeatures) {
# you aren't using @ids so I remove it
# push @ids, $feat_object->get_tag_values("host") if ($feat_object->has_tag("host"));
if ($feat_object->has_tag("host")) {
($host_name) = $feat_object->get_tag_values('host')
}
}
$seq->display_id($host_name);
$seq->description(''); # get rid of description I guess
$out->write_seq($seq);
}
Output
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31
perl HostGrabber.pl sequence.gb
>Unknown
>Unknown
GCCCCGTTTTTTGAAATGGGTTCTATTCCCAAACCGTGTATACATACCTATGTTGCTTTGGTAGGCCGCCTTTTAGGCGTCGGCTCCGGCTGACTGCGCCTGCCAGAGGACCCAAACTCTTTTGTTTAGTGATGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTATAACCACTCAAGCCTCGGCTTGGTCTTGGGGTTCGCGGTCTCGCGG
>Unknown
>Unknown
TCTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACAGAGTTCATGCCCTTACGGGTAGATCTCCCACCCTTTGAGTACTATACTTTTGTTGCTTTGGCAGGCCGCTTCGGCTACCGGCTTCGGCTGGTGAGTGCCTGCCAGAGGACCCCAAACTCTGAATTATAGTGTCGTCTGAGAACTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGGGGGGCATGCCTGTTCGAGCGTCATTATAACCCTCAAGCCTAGCTTGGTGTTGGAGCCTGCCTCTGGGCAGCTCTTAAAATCAGTGGCGGTGCCGTCTGGCTCTAAGCGTAGTAATTCTTCTCGCTACAGAGTCCCGGCGGTTGCTTGCCAACAACCCCAAATTTTCTATGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAA
>Unknown
>Unknown
TGGTAAGAGAGTGCAGGATGAACAATGGACGATCCGCAGCGAAGACCCTACCGGCGAGAGCCCACGGGTACCGTTCACAGACTAAGTGATTGTGGGCGGGGCGTCAGGCCCTGTCTAAGATATAGTCGGTCTCTGCTCGAAAGGTCAGAGCCTAGCGCGTCCGTAGGTGAACCTGCGGAAGGATCATTAAAGAATCGCCCCGTTTTTTGAAATGGGTTCTATTCCCAAACCGTGTATACATACCTTTGTTGCTTTGGTAGGCCGCCTTCTAGGCGTCGGCTCCGGCTGACTGCGCCTGCCAGAGGACCCAAACTCGTTTGTTTAGTGATGTCTGAGTACTATATAATAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTACAACCAC
>Unknown
>Unknown
AGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACTGAACTGTTGACACGAGTTGTTGCTGGTCCTTGAAAGGGGGCATGTGCACACTCTGTTTACACATCCACTCACACCTGTGCACCCTCTGTAGTTCTGTGGCATTGGGGACTCTGTCCTCTTGCTGTGGTCCTACGTCTTTACACACACACACCGTAATACAGTCTCATGGAATGTATGTCGCGTTTAACGCAATACAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGCTATTCCGAAGGGCATGCCTGTTTGAGTATCATGAACACCTCAACTCTCATGGCCTGCCATGATGAGCTTGGATTTTGGGGGTCTTGCTGGCCTAACCGTCGGCTCCTCTCAAATGAATCAGCTTGCCAGTGTTTGGTGGCATCACAGGTGTGATAACTATCTACGCTTGTGGTTCTCCACCAGGTAACCTTCAGCAATGGAGGTTCGCTGGAGCTCACAGATGTCTCTCCCCAGGGACAGCTTTTTGAACGTTTGATCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAA
>Unknown
>Unknown
ACACGAGTTGTTGCTGGTCCTCAAACGGGGGCATGTGCACGCTCTGTTCACACATCCACTCACACCTGTGCACCCTCTGTAGTTCTATGGTCTGGGGGGGCTCTGCCCTCTCGCCGTGGTTCTATGTCTTTACACACGCACTGTAATAAAGTTTCATGGAATGCATGACGCGTTTAACGCAATACAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGTATTCCAGAGGGCATGCCTGTTTGAGTATCATGAACACCTCAACTCTCACGGTCCGCCGTGATGAGCTTGGACTTTGGGGGTCTTGCTGGCCTGCGGGTCGGCTCCTCTCAAATGAATCAGCTTGCCAGTGTTTGGTGGCATCACGGGTGTGATAACTATCTACGCTTGTGGTTTTCCACCAGGTAACCTTCAGCAATGGAGGTTCGCTGGGGCTCACAAATGTCTCTCCTCGGTGAGGACAACTTCTTGAATGTTTGATCTCAAATCAGGTAGGGCTACCCGCTGAACTTAAGCATATCAATAA
>Fagus sylvatica
>Unknown
AGGGGGCATGTGCACGCTCTGTTCACACATCCACTCACACCTGTGCACCCTCTGTAGTTCTATGGTCTGGAGGATGCACCGTCTTCCTTCTGTAGTTCTACGTCTTTACACATACGCCCTAGTGAAGTTTTATGGAATGTGTGCCGCGTCTAACGCAATACAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGATATTCTGAGGGGCATGCCTGTTTGAGTATCATGAACACCTCAACTCCTCATGGTTTGCCGTGATGAGCTTGGACTTTTGGAGGTTTTGCTGGCCCTGCTGTCGGCTCCTCTCAAATGGATCAGCTTGCCAGTGTTTGGTGGCGTCATGGGTGTGATAACTATCTACGCTTGTGGCCGTCTGCCAGGTA
>Fagus sylvatica
>Unknown
AGGTGAACCTGCGGAAGGATCATTATTGATAGTTTGTATTATCAAAAACCCCTTTGTTTATCATTTACCATGTTGCTTCCATTGGACAGACCGGCAATTGTGTATACAAAAAGTTGGTCCTCTAGTTTTGTGTTTATTTGGCACTAGCTAGGGAGCTGCCAGTGGATAGAATCCAAATAAAAAATTCGTGAAGAAATATATATTGTCTGATTTATTAGTATAAAAAAAATAAAACTTTCAACAACGGATCTCTAGGCTCTTGCATCGATGAAGAACGCAGTGAAATGCGATAAGTAATGTGAATTGCAGAATCTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTATGGAATTCTGTAGGGCATGCCTGTCTGAGCGTCAGCAGCCAAAAAAATCCAAATCTTTGTAGATAAAGATTTGGATTTGGTTAAGAGATGTAATCTGTGTAAGAACCGGTTACTCTTTTGAAATTTAAAGGCAGTATTGATCAATCCAACTGTAAACGTGATAAAACATTTCGTTTTTATTGTTCGGAATGAGC
>Fagus sylvatica
>Unknown
TTGGGATCATCTCGGAGGGGGCTCGCGTTTTCACACAAACCCCCCTTTTAAAAGTGTAGAATGACCTCATTTATGCGCTAACCCGCAATCAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCACACCCGTTTGAGTGTCGTGAAAACCTCAACCTCCTTGGTTTCTTCTGGAGACCAAAGCAGGCTTGGACTTTGGAGGCCTTTGCTGGCACCTCTCTTTTGAAGGCCAGCTCCTCTTAAACAAATTAGCAGGGTCCTCTTTGCCGATCCTCGACGTGTGATAAG
>Fagus sylvatica
>Unknown
GGATGCATGTGCTTGCCCTAACAATCATCTTCCAAACACCTGTGCACATTTTTGAGGGAGTTTCGAGTTTTATTGCCGTTTTTGGTGATTTTCTTGTATTCCCTTGAATTATTATACGCTGTTAACAATGATGAACGTGCTCTGTGCCGCAAGGCCATTAATATAATACAACTTTTAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCCTGGTATTCCGGGGAGCACGCCTGTTCGAGTGTCGCGAAATTTCTCAAGCTTGGATGGCCTTTTTGTCTGTCCTTAGCCTTGGTTGTTGGGCTTTGCCGTGTCCTTTGTTGGGACGGCTGGCCTTAAAAGCATTAGCTGATCCTCGTGTGGCACTGGTTCTACTCAGCGTGATAACAGTCTGATCGCTGAGGA
>Fagus sylvatica
>Unknown
GAGGGAGTTTCGAGTTTTATTGCCGTTTTTGGTGATTTTCTTGTATTCCCTTGAATTATTATACGCTGTTAACAATGATGAACGTGCTCTGTGCCGCAAGGCCATTAATATAATACAACTTTTAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCCTGGTATTCCGGGGAGCACGCCTGTTCGAGTGTCGCGAAATTTCTCAAGCTTGGATGGCCTTTTTGTCTGTCCTTAGCCTTGGTTGTTGGGCTTTGCCGTGTCCTTTGTTGGGACGGCTGGCCTTAAAAGCATTAGCTGATCCTCGTGTGGCACTGGTTCTACTCAGCGTGATAACAGTCTGATCGCTGAGGA

Please sign in to comment on this gist.

Something went wrong with that request. Please try again.