Skip to content

Instantly share code, notes, and snippets.

@naomiajacobs
naomiajacobs / optimization.py
Last active Jan 1, 2021
bnt162b2 Vaccine Codon Optimization
View optimization.py
from dnachisel import *
# Subbed in `CCTCCT` for `AAAGTT` to account for proline substitution
virus = 'ATGTTTGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCTTACAACCAGAACTCAATTACCCCCTGCATACACTAATTCTTTCACACGTGGTGTTTATTACCCTGACAAAGTTTTCAGATCCTCAGTTTTACATTCAACTCAGGACTTGTTCTTACCTTTCTTTTCCAATGTTACTTGGTTCCATGCTATACATGTCTCTGGGACCAATGGTACTAAGAGGTTTGATAACCCTGTCCTACCATTTAATGATGGTGTTTATTTTGCTTCCACTGAGAAGTCTAACATAATAAGAGGCTGGATTTTTGGTACTACTTTAGATTCGAAGACCCAGTCCCTACTTATTGTTAATAACGCTACTAATGTTGTTATTAAAGTCTGTGAATTTCAATTTTGTAATGATCCATTTTTGGGTGTTTATTACCACAAAAACAACAAAAGTTGGATGGAAAGTGAGTTCAGAGTTTATTCTAGTGCGAATAATTGCACTTTTGAATATGTCTCTCAGCCTTTTCTTATGGACCTTGAAGGAAAACAGGGTAATTTCAAAAATCTTAGGGAATTTGTGTTTAAGAATATTGATGGTTATTTTAAAATATATTCTAAGCACACGCCTATTAATTTAGTGCGTGATCTCCCTCAGGGTTTTTCGGCTTTAGAACCATTGGTAGATTTGCCAATAGGTATTAACATCACTAGGTTTCAAACTTTACTTGCTTTACATAGAAGTTATTTGACTCCTGGTGATTCTTCTTCAGGTTGGACAGCTGGTGCTGCAGCTTATTATGTGGGTTATCTTCAACCTAGGACTTTTCTATTAAAATATAATGAAAATGGAACCATTACAGATGCTGTAGACTGTGCACTTGACCCTCTCTCAGAAACAAAGTGTACGTTGAAATCCTTCAC
@naomiajacobs
naomiajacobs / googleSheetsGithubPRVisualization.js
Last active Mar 7, 2018
Google Sheets Github PR Visualization
View googleSheetsGithubPRVisualization.js
/*
To use this script:
1. Make a tab in your Google Sheet called "Branch Strategy".
2. Open the script editor for that Sheet by navigating to Tools > Script Editor.
3. Copy and paste this file into the editor there.
4. Replace YOUR_MILESTONE_NUMBER with the milestone your team uses to manage its PRs.
5. Replace YOUR_GITHUB_TOKEN with your Github token.
6. Add a trigger to run the `onOpen` function From spreadsheet onOpen.
7. Save the script.
View WebpackBlogPostCode.js
var files = [fileA, fileB, fileC];
function(files) {
var cache = {};
function webpackRequire(index) {
var module = {
exports: {},
cached: false,
};
View loggerMiddleware.jsx
const logger = store => next => action => {
console.log('Action: ', action);
console.log('Next state: ', store.getState());
return next(action);
};
// const logger = function(store) {
// return function(next) {
// return function(action) {
// console.log('Action: ', action);