Instantly share code, notes, and snippets.

@rdmpage /primers.txt
Last active May 17, 2018

What would you like to do?
COI DNA barcode primer locations
Reference COI is NC_003128 Buteo buteo COI
TZBRD035-15.COI-5P [648bp] ctgatctttggtgnatgagcaggcatagccggcacagcacttagcctactaatccgcgcagaactaggacagccaggaacactattgggagacgaccaaatctacaatgtaatcgtaacagcccacgctttcgtcataatcttcttcatagtcatacctattatgatcggaggcttcggaaactgactggttccactcataattggcgccccagacatagcattcccccgcataaataatatgagcttctgactcctcccaccttcttttctcctcctactagcctcctctacagtagaagccggggctggcactggatgaactgtttatccacccctagccggtaatcttgcccacgcgggcgcatcagtagacctggctattttttcccttcacttggcaggcgtgtcgtccatcttaggagctattaactttatcaccacaattattaacataaagccccctgcactatcacaatatcaaacacccctcttcgtatgatccgtcctcattactgctatcctcttactactatccctgccagtcctagccgccgggattacaatactcctcaccgatcgcaacctcaacactacattctttgaccctgcaggaggaggagacccaatcctgtatcaacacctattc
TZBRD019-15.COI-5P tcttcggcgcctgagctggtatagtcggcaccgccctcagcttactcatccgtgcagaactcggccaacccggcacactcctaggtgacgaccaaatttataacgtaatcgttaccgcacatgccttcgtaataatcttcttcatagttataccaatcatgatcggaggattcggaaactgacttgttccactcataattggcgctcccgacatagcctttccacgcataaacaacataagcttctgactactccccccatccttcctcctcctactagcttcctcaacagtagaagcaggagccggtactggatgaactgtctatcctcccttagctggcaacatagcccatgccggagcttcagtagacctagccatcttctctctacacttagccggagtttcatccattctaggggcgatcaacttcatcacaaccgccattaatataaaacccccagcactctcccagtaccaaacacccctgtttgtatgatctgtactcatcactgccgtccttctactactctcactcccagtcctagccgctggcatcactatactacttacagaccgaaacctaaacacaacattctttgaccctgccggcggaggcgatcccatcctctaccaacatctcttc
SYROC231-15.COI gacactttatttcatttttggagcttgagcaggaatagtgggaacatctttaagaattttaattcgaacagaattaggtcatccaggagctttaattggtgatgatcaaatttataatgtaattgtaacagctcatgcttttgtaataattttttttatagtaatacctattataattggaggtttcggaaactgattagttcctttaatattaggagctcctgatatagcttttcctcgaataaataatataagtttttgaatacttcccccatctcttactcttcttcttataagaagtatagtagaaaatggagctggaactggctgaaccgtttaccctcccctttcttctactattgctcatagaggagcttcagttgatttagctattttttctcttcatcttgctggaatttcttcaattttaggagcagtaaattttattactacagtaattaatatacgaagctctggaattttatttgatcgaatacctttatttgtctgatcagtattaattactgctattcttttattattatctcttccagttttagcaggagcaattactatattattaactgatcgaaatttaaatacatccttttttgatcctgcaggtggaggtgatcctattttatatcaacacttattt
FARAN267-14.COI-5P (fish) cctttatctagtatttggtgcctgagccggaatagtaggcacagctctaagcctcctcattcgagcggagctaagccaacccggcgccctcctgggagacgaccaaatttataatgtccttgttacagcgcatgcgttcgtaataatcttctttatagtaataccaattatgatcgggggttttggaaactgacttgtacccttgataatcggggccccggacatagcattcccccggataaacaacatgagcttttgactccttcccccatcttttctcctcctccttgcctcttcgggggtggaggcgggcgctggaacggggtgaacagtttacccccctctctcaggtaacttagcccacgcaggggcctccgttgatttaacaatcttttccctccacctagcaggaatttcttcgatcctcggagcaattaatttcattacaaccatcatcaacatgaaaccccctgcgatctctcagtaccagacacccctcttcgtctggtccgtacttgtcacggcggtcctgctcctcctctctcttcccgtcctcgcagccggtatcactatgctcctgacagatcgtaacctaaacaccaccttcttcgaccccgccgggggaggagacccaatcctttaccaacacctg
|| || |||||||| || || || || || ||||||||| | || |||||| | || || |||||||||||||||||
minbarF1 tccactaatcacaargatattggtac gctcatgccttcattatgattttc minibarR1 reverse complement caggatttggaattatctcccacgt BirdR1
| | | | | |
1 54 61 180 708 748
BirdF1 ttctccaaccacaaagacattggcac
minbarF1 tccactaatcacaargatattggtac
minbarR1 gaaaatcataatgaaggcatgagc
A universal DNA mini-barcode for biodiversity analysis
Applicability of DNA barcoding to museum specimens of birds from the Democratic Republic of the Congo
Hebert, P. D. N., Stoeckle, M. Y., Zemlak, T. S., & Francis, C. M. (2004, September 28). Identification of Birds through DNA Barcodes. (Charles Godfray, Ed.)PLoS Biology. Public Library of Science (PLoS).

This comment has been minimized.

Show comment
Hide comment

rdmpage commented May 10, 2016

44835517 500 500


This comment has been minimized.

Show comment
Hide comment

rdmpage May 17, 2018

NGS barcodes used in Rudolf Meier's lab, e.g. Meier, R., Wong, W., Srivathsan, A., & Foo, M. (2015). $1 DNA barcodes for reconstructing complex phenomes and finding rare species in specimen-rich samples. Cladistics, 32(1), 100–110. doi:10.1111/cla.12115

Below is traditional COI barcode from LC096192 and NGS barcode KP461672 for same species, with the m1CO1intF primer (forward). Bird COI sequence and mini barcode primer from above is shown for comparison (insect sequences are aligned with bird sequence to make coordinates compatible).

Tanytarsus oscillans $1 barcode NGS
LC096192.1                                         aacattatattttatttttggagcctgatctggaatagtagggacttctttaagtatactaatccgtgcagaattaggacaccccggaacatttatcggtgatgaccaaatttataatgtaattgttacagcccacgcttttattataattttttttatagttatgcctattttaattggaggatttggaaattgacttcttcctttaatattaggggccccagatatagccttccctcgaataaataatataagtttttgacttttaccaccctctcttacacttcttctttctagttcaattgtagaaaatggagccggaacaggatgaacagtttatcctcccctatctgctagaattgctcacagaggggcttctgttgatttagctattttttctcttcatcttgcagggatttcttctattttaggatctgtaaattttattactactgctattaatatacgagcaaatggaattacccttgatcgcatacccttatttgtttgatcagttgtaattacaactgttcttcttcttctttcccttccggttcttgctggtgcaattactatacttttaacagatcgaaatttaaatacttcattttttgatccagcaggaggaggagatcctattctttatcaacacttattt
KP461672                                                                                                                                                                                                                                                                                                                                                                                                    cctatctgctagaattgctcatagtggagcctctgttgatttagctattttttctcttcaccttgcaggaatttcttccattttaggttcagtaaattttattactacagctatcaatatacgagcaaatggaattacacttgaccgaatacctttatttgtttgatccgttgtaattacaactgttctccttcttctttcccttccagttctagctggtgcaattactatacttttaacagaccgaaatttaaacacatcattttttgacccggcaggaggaggggaccctatcctctatcaacatttattt
                                                                                                                                                                                                                                                                                                                                                                                  || || || ||||| || || || ||
                                                                                                                                                                                                                                                                                                                                                                  m1CO1intF       GGWACWGGWTGAACWGTWTAYCCYCC                                                                                                                                                                                                                                                                                                                         
                           || || |||||||| || || || ||                                                                                                                               || ||||||||| | || ||||||                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                | || || |||||||||||||||||
              minbarF1     tccactaatcacaargatattggtac                                                                                                                               gctcatgccttcattatgattttc minibarR1 reverse complement                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   caggatttggaattatctcccacgt BirdR1

rdmpage commented May 17, 2018

NGS barcodes used in Rudolf Meier's lab, e.g. Meier, R., Wong, W., Srivathsan, A., & Foo, M. (2015). $1 DNA barcodes for reconstructing complex phenomes and finding rare species in specimen-rich samples. Cladistics, 32(1), 100–110. doi:10.1111/cla.12115

Below is traditional COI barcode from LC096192 and NGS barcode KP461672 for same species, with the m1CO1intF primer (forward). Bird COI sequence and mini barcode primer from above is shown for comparison (insect sequences are aligned with bird sequence to make coordinates compatible).

Tanytarsus oscillans $1 barcode NGS
LC096192.1                                         aacattatattttatttttggagcctgatctggaatagtagggacttctttaagtatactaatccgtgcagaattaggacaccccggaacatttatcggtgatgaccaaatttataatgtaattgttacagcccacgcttttattataattttttttatagttatgcctattttaattggaggatttggaaattgacttcttcctttaatattaggggccccagatatagccttccctcgaataaataatataagtttttgacttttaccaccctctcttacacttcttctttctagttcaattgtagaaaatggagccggaacaggatgaacagtttatcctcccctatctgctagaattgctcacagaggggcttctgttgatttagctattttttctcttcatcttgcagggatttcttctattttaggatctgtaaattttattactactgctattaatatacgagcaaatggaattacccttgatcgcatacccttatttgtttgatcagttgtaattacaactgttcttcttcttctttcccttccggttcttgctggtgcaattactatacttttaacagatcgaaatttaaatacttcattttttgatccagcaggaggaggagatcctattctttatcaacacttattt
KP461672                                                                                                                                                                                                                                                                                                                                                                                                    cctatctgctagaattgctcatagtggagcctctgttgatttagctattttttctcttcaccttgcaggaatttcttccattttaggttcagtaaattttattactacagctatcaatatacgagcaaatggaattacacttgaccgaatacctttatttgtttgatccgttgtaattacaactgttctccttcttctttcccttccagttctagctggtgcaattactatacttttaacagaccgaaatttaaacacatcattttttgacccggcaggaggaggggaccctatcctctatcaacatttattt
                                                                                                                                                                                                                                                                                                                                                                                  || || || ||||| || || || ||
                                                                                                                                                                                                                                                                                                                                                                  m1CO1intF       GGWACWGGWTGAACWGTWTAYCCYCC                                                                                                                                                                                                                                                                                                                         
                           || || |||||||| || || || ||                                                                                                                               || ||||||||| | || ||||||                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                | || || |||||||||||||||||
              minbarF1     tccactaatcacaargatattggtac                                                                                                                               gctcatgccttcattatgattttc minibarR1 reverse complement                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                                   caggatttggaattatctcccacgt BirdR1
Sign up for free to join this conversation on GitHub. Already have an account? Sign in to comment