Skip to content

Instantly share code, notes, and snippets.

Roderic Page rdmpage

Block or report user

Report or block rdmpage

Hide content and notifications from this user.

Learn more about blocking users

Contact Support about this user’s behavior.

Learn more about reporting abuse

Report abuse
View GitHub Profile
@rdmpage
rdmpage / README.md
Last active Oct 3, 2018
OpenBioDiv query to get specimens from MNRJ
View README.md

OpenBioDiv query to get specimens from MNRJ

Query by Viktor Senderov:

"In order to illustrate the capabilities of OpenBiodiv and draw attention to the impact of the tragically lost collection of the Museu Nacional de Rio de Janeiro (MNRJ), I can ask our system to give me the number of times a specimen from that collection was used in a taxonomic article, and in which ones."

http://big4-project.eu/news/11665_blog-post-openbiodiv-the-semantic-web-comes-to-biodiversity-informatics/

See query at https://goo.gl/4ovg2o

@rdmpage
rdmpage / clements2017-2018.html
Last active Sep 19, 2018
Comparison of eBird checklists for 2017 and 2018
View clements2017-2018.html
<html>
<head>
<style>
html, body{
width:100%;
height:100%;
font-size:14px;
}
#wrapper {
padding:1%;
@rdmpage
rdmpage / cltools.sh
Created Nov 10, 2017 — forked from justinbellamy/cltools.sh
Install Autoconf and Automake on OS X El Capitan
View cltools.sh
#!/bin/sh
##
# Install autoconf, automake and libtool smoothly on Mac OS X.
# Newer versions of these libraries are available and may work better on OS X
#
# This script is originally from http://jsdelfino.blogspot.com.au/2012/08/autoconf-and-automake-on-mac-os-x.html
#
export build=~/devtools # or wherever you'd like to build
@rdmpage
rdmpage / jsonld.sh
Created Apr 18, 2017 — forked from jprante/jsonld.sh
JSON-LD in Elasticsearch
View jsonld.sh
curl -XDELETE 'localhost:9200/jsonld'
curl -XPOST 'localhost:9200/jsonld'
curl -XPUT 'localhost:9200/jsonld/doc/1' -d '
{
"@context":
{
"dc": "http://purl.org/dc/elements/1.1/",
View Multiple identifiers
== Handling multiple identifiers
Many objects of interest will have multiple identifiers, and each identifier may have different, complementary data associated with it.
One approach is to treat each identifier as a node, and link it to node for the corresponding object (essentially the object is treated as a bnode). We therefore refer to an object as "the object identifier by <identifier>". If we have correctly associated multiple identifiers with the same object, then we can link the two objects together.
When we have a link to create to another object, we use MERGE (id)-[]-(object) to ensure that id-object exists, then we link to it. In the example below we have a work with DOI 10.3897/phytokeys.44.7993, which cites PMID 21653447. First we create the work with DOI 10.3897/phytokeys.44.7993.
//hide
//setup
@rdmpage
rdmpage / query.txt
Created May 19, 2016
Querying Wikipedia for links to BioStor
View query.txt
The Mediawiki API can be used to find qhat wikipedia pages link to BioStor, e.g.:
https://en.wikipedia.org/w/api.php?action=query&list=exturlusage&euquery=biostor.org&eulimit=20
See https://www.mediawiki.org/wiki/API:Lists/All#Exturlusage for details.
View Cricula.nexus
#NEXUS
Begin trees; [Treefile saved Thu Aug 20 21:42:14 2015]
[!
>Data file = /Users/rpage/Sites/geojson-phylogeny-demo/bold-api/service/tmp/SAUPA642-10/SAUPA642-10.nex
>Neighbor-joining search settings:
> Ties (if encountered) will be broken systematically
> Distance measure = uncorrected ("p")
> (Tree is unrooted)
]
@rdmpage
rdmpage / Cricula.geojson
Last active May 10, 2016
Cricula barcode map
View Cricula.geojson
Sorry, something went wrong. Reload?
Sorry, we cannot display this file.
Sorry, this file is invalid so it cannot be displayed.
@rdmpage
rdmpage / primers.txt
Last active May 17, 2018
COI DNA barcode primer locations
View primers.txt
Reference COI is NC_003128 Buteo buteo COI
TZBRD035-15.COI-5P [648bp] ctgatctttggtgnatgagcaggcatagccggcacagcacttagcctactaatccgcgcagaactaggacagccaggaacactattgggagacgaccaaatctacaatgtaatcgtaacagcccacgctttcgtcataatcttcttcatagtcatacctattatgatcggaggcttcggaaactgactggttccactcataattggcgccccagacatagcattcccccgcataaataatatgagcttctgactcctcccaccttcttttctcctcctactagcctcctctacagtagaagccggggctggcactggatgaactgtttatccacccctagccggtaatcttgcccacgcgggcgcatcagtagacctggctattttttcccttcacttggcaggcgtgtcgtccatcttaggagctattaactttatcaccacaattattaacataaagccccctgcactatcacaatatcaaacacccctcttcgtatgatccgtcctcattactgctatcctcttactactatccctgccagtcctagccgccgggattacaatactcctcaccgatcgcaacctcaacactacattctttgaccctgcaggaggaggagacccaatcctgtatcaacacctattc
TZBRD019-15.COI-5P tcttcggcgcctgagctggtatagtcggcaccgccctcagcttactcatccgtgcagaactcggccaacccggcacactcctaggtgacgaccaaatttataacgtaatcgttaccgcacatgccttcgtaataatcttcttcatagttataccaatcatgatcggaggattcggaaactgacttgttccactcataattggcgctc
@rdmpage
rdmpage / index.html
Last active Apr 20, 2016
Query GBIF by drawing on map
View index.html
<!DOCTYPE html>
<html>
<head>
<title>GBIF search</title>
<meta charset="utf-8" />
<link
rel="stylesheet"
href="http://cdn.leafletjs.com/leaflet-0.7/leaflet.css"
/>
<link
You can’t perform that action at this time.