Skip to content

Instantly share code, notes, and snippets.

Roderic Page rdmpage

View GitHub Profile
View gist:acb35ad544000deafb8964341071ff55
910
1984
 DZRJ
-
()
(UB 19881)
(UB 19882)
(UFG 13985)
(UFG 13986)
*
@rdmpage
rdmpage / primers.txt
Last active May 17, 2018
COI DNA barcode primer locations
View primers.txt
Reference COI is NC_003128 Buteo buteo COI
TZBRD035-15.COI-5P [648bp] ctgatctttggtgnatgagcaggcatagccggcacagcacttagcctactaatccgcgcagaactaggacagccaggaacactattgggagacgaccaaatctacaatgtaatcgtaacagcccacgctttcgtcataatcttcttcatagtcatacctattatgatcggaggcttcggaaactgactggttccactcataattggcgccccagacatagcattcccccgcataaataatatgagcttctgactcctcccaccttcttttctcctcctactagcctcctctacagtagaagccggggctggcactggatgaactgtttatccacccctagccggtaatcttgcccacgcgggcgcatcagtagacctggctattttttcccttcacttggcaggcgtgtcgtccatcttaggagctattaactttatcaccacaattattaacataaagccccctgcactatcacaatatcaaacacccctcttcgtatgatccgtcctcattactgctatcctcttactactatccctgccagtcctagccgccgggattacaatactcctcaccgatcgcaacctcaacactacattctttgaccctgcaggaggaggagacccaatcctgtatcaacacctattc
TZBRD019-15.COI-5P tcttcggcgcctgagctggtatagtcggcaccgccctcagcttactcatccgtgcagaactcggccaacccggcacactcctaggtgacgaccaaatttataacgtaatcgttaccgcacatgccttcgtaataatcttcttcatagttataccaatcatgatcggaggattcggaaactgacttgttccactcataattggcgctc
@ilevantis
ilevantis / EvolDir-RSSifier.php
Created Feb 27, 2016
Turn EvolDir categories into RSS feeds
View EvolDir-RSSifier.php
<?php
header('Content-Type: application/rss+xml; charset=UTF-8');
$list_name = htmlspecialchars($_GET['lname']);
$list_url = 'http://life.mcmaster.ca/cgi-bin/my_wrap/brian/evoldir/'.$list_name.'/';
$month_num = array (
"Jan" => 1,
"Feb" => 2,
@nickynicolson
nickynicolson / name-reconciliation-python.ipynb
Last active Feb 12, 2016
Name reconciliation in Python
View name-reconciliation-python.ipynb
Sorry, something went wrong. Reload?
Sorry, we cannot display this file.
Sorry, this file is invalid so it cannot be displayed.
@justinbellamy
justinbellamy / cltools.sh
Last active Jun 1, 2020 — forked from jellybeansoup/cltools.sh
Install Autoconf and Automake on OS X El Capitan
View cltools.sh
#!/bin/sh
##
# Install autoconf, automake and libtool smoothly on Mac OS X.
# Newer versions of these libraries are available and may work better on OS X
#
# This script is originally from http://jsdelfino.blogspot.com.au/2012/08/autoconf-and-automake-on-mac-os-x.html
#
export build=~/devtools # or wherever you'd like to build
@liamato
liamato / decodeHtmlEntities.js
Created Oct 29, 2015
decodeHtmlEntities.js
View decodeHtmlEntities.js
/**
* Decodes html entities by name and number
*/
var decodeHtmlEntities = function(str) {
return str.replace(/&#?(\w+);/g, function(match, dec) {
if(isNaN(dec)) {
chars = {quot: 34, amp: 38, lt: 60, gt: 62, nbsp: 160, copy: 169, reg: 174, deg: 176, frasl: 47, trade: 8482, euro: 8364, Agrave: 192, Aacute: 193, Acirc: 194, Atilde: 195, Auml: 196, Aring: 197, AElig: 198, Ccedil: 199, Egrave: 200, Eacute: 201, Ecirc: 202, Euml: 203, Igrave: 204, Iacute: 205, Icirc: 206, Iuml: 207, ETH: 208, Ntilde: 209, Ograve: 210, Oacute: 211, Ocirc: 212, Otilde: 213, Ouml: 214, times: 215, Oslash: 216, Ugrave: 217, Uacute: 218, Ucirc: 219, Uuml: 220, Yacute: 221, THORN: 222, szlig: 223, agrave: 224, aacute: 225, acirc: 226, atilde: 227, auml: 228, aring: 229, aelig: 230, ccedil: 231, egrave: 232, eacute: 233, ecirc: 234, euml: 235, igrave: 236, iacute: 237, icirc: 238, iuml: 239, eth: 240, ntilde: 241, ograve: 242, oacute: 243, ocirc: 244, otilde: 245, ouml: 246, divide: 247, oslash: 248, ugrave: 249
@edsu
edsu / gist:c95c9ae9f60ecdf80077
Last active Jan 21, 2016
Look up WikiData ID based using a Freebase ID. Possibly useful if you have lots of Freebase ids and want to turn them into WikiData ids when Freebase goes the way of the Dodo in June.
View gist:c95c9ae9f60ecdf80077
% curl --silent 'https://wdq.wmflabs.org/api?q=string\[646:/m/04hcw\]' | python -mjson.tool
{
"items": [
9391
],
"status": {
"error": "OK",
"items": 1,
"parsed_query": "STRING[646:'/m/04hcw']",
"querytime": "113ms"
@tomzeppenfeldt
tomzeppenfeldt / gist:40364ac2a52f57aa520a
Last active Aug 29, 2015
Network versioning using transition nodes
View gist:40364ac2a52f57aa520a
= Network versioning using relationnodes
Recently there was a nice blog on versioning networks by Ian Robinson (http://iansrobinson.com/2014/05/13/time-based-versioned-graphs/[read it here]) on using identity nodes and separating structure from state. In this gist I'd like to put in my 2 cents by introducing another approach using _relationnodes_. This is more about structure of a network than about states of nodes, but it treats versioning differently. As Ian states in his blog, there's always a trade-off to be made, since versioning causes an extra load on storage and processing.
== Relationnodes?
=== What are relationnodes?
Relation nodes are intermediary nodes between two network nodes that represents the relation between the nodes.
So, if A and B are two network nodes, instead of connecting them with a relationship of `[:RELTYPE]`,
@umidjons
umidjons / sort-object-properties-by-value.md
Last active Jun 29, 2020
JavaScript: sort object properties by value (numeric or string)
View sort-object-properties-by-value.md

Sort object properties by value (values are text)

I have following object:

var cities={10:'Tashkent', 14:'Karakalpakiya', 16:'Andijan'};

I want sort it by city names, so after sort it should be:

var cities={16:'Andijan', 14:'Karakalpakiya', 10:'Tashkent'};

But I can't sort object properties, instead can convert object into array, then sort items.

@brentsimmons
brentsimmons / JavaScript Indent.js
Last active May 16, 2020
This is a BBEdit text filter for indenting (and beautifying) JavaScript.
View JavaScript Indent.js
#!/usr/local/bin/node
// PBS 12/5/13
// This is a BBEdit text filter for indenting (and beautifying) JavaScript.
// It goes in ~/Library/Application Support/BBEdit/Text Filters/
//
// On my machine I assigned it a keyboard shortcut: cmd-'
//
// It requires the js-beautify Node module: https://github.com/einars/js-beautify
//
You can’t perform that action at this time.