Antes de tudo, seria mais fácil fazer um mapa em db.drawing para percebermos a arquitetura da base de dados e suas ligações. Mas vamos pelo que nos é proposto. Usando a caixa de comandos para verificar o interior das tabelas.
Verificar a tabela person a ver a quantidade de pessoas que existem
SELECT *
| ACAAGATGCCATTGTCCCCCGGCCTCCTGCTGCTGCTGCTCTCCGGGGCCACGGCCACCGCTGCCCTGCCCCTGGAGGGTGGCCCCACCGGCCGAGACAGCGAGCATATGCAGGAAGCGGCAGGAATAAGGAAAAGCAGCCTCCTGACTTTCCTCGCTTGGTGGTTTGAGTGGACCTCCCAGGCCAGTGCCGGGCCCCTCATAGGAGAGGAAGCTCGGGAGGTGGCCAGGCGGCAGGAAGGCGCACCCCCCCAGCAATCCGCGCGCCGGGACAGAATGCCCTGCAGGAACTTCTTCTGGAAGACCTTCTCCTCCTGCAAATAAAACCTCACCCATGAATGCTCACGCAAGTTTAATTACAGACCTGAA |
| # Homework 11: DNA (person) + Country Capital | |
| # devemos de estudar como chamar dict's e list : | |
| # https://www.datacamp.com/community/tutorials/f-string-formatting-in-python?utm_source=adwords_ppc&utm_campaignid=898687156&utm_adgroupid=48947256715&utm_device=c&utm_keyword=&utm_matchtype=b&utm_network=g&utm_adpostion=&utm_creative=229765585183&utm_targetid=dsa-429603003980&utm_loc_interest_ms=&utm_loc_physical_ms=1011781&gclid=CjwKCAjwm7mEBhBsEiwA_of-TBkwp8iKmqtG3hwEqGRg6xtc665FNQhdzB9jfiC4N4vuNbdDzOmcsBoCfs4QAvD_BwE | |
| import random | |
| countries_cities = {"Austria": "Vienna", "Croatia": "Zagreb", "Spain": "Madrid", "Slovenia": "Ljubljana"} # dict <key>: <value>, # create a dictionary, key is the state and value is the capital | |
| question = list(countries_cities.keys()) # colocar a lista para poder separá-la. há o keys, values e o items |
| # Homework 8.3: FizzBuzz | |
| game_start = int(input("Select a number between 1 and 100: ")) | |
| for ciclo_start in range(1, game_start+1): | |
| if ciclo_start % 5 == 0 and ciclo_start % 3 == 0: # resultados | |
| print("fizzbuzz") | |
| elif ciclo_start % 5 == 0: | |
| print("buzz") | |
| elif ciclo_start % 3 == 0: |
| # Homework 8.3: Calculator of Golden Ratio & Fibonacci Sequence | |
| pt = 0.75292857248934 | |
| rem = 0.0625 | |
| x = 1.618 | |
| nterms = 10 | |
| # Python program to display the Fibonacci sequence | |
| def recur_fibo(n): | |
| if n <= 1: |
| # Homework 9.3: Make String joining Lowercase | |
| str_one = "Today Is a Beautiful Day vs" # i didn't added space, see the result spaces between words | |
| str_two = "Today is a terrible Day" | |
| print(str_one.lower() + str_two.lower()) # no space added | |
| print(str_one.lower() + " " + str_two.lower()) # space add a virgula faz um espaço | |
| print("%s %s" % (str_one.lower(), str_two.lower())) # space add | |
| print("{0} {1}".format(str_one.lower(), str_two.lower())) # space add |
There is two problems:
#1 When inspect the footer does not belong with the page and it not shrink the page height. #1.1 Footer text not being responsive with the page #2 Header when reducing the space between them are not the same. #2.1 The image header (dots) need to be always at the same size independentment the viewport.
SOLUTIONS_?
** Description: ** This program from Smart Ninja. Comes to challenge the group of Web Development 1 to propose the various solutions for the challenge and discuss what it is the one that is more correct on a Web Development Website.
## Tree different solutions:
| <!DOCTYPE html> | |
| <html lang="en"> | |
| <head> | |
| <meta charset="UTF-8"> | |
| <meta name="description" content="My Fakebook"> | |
| <meta name="keywords" content="Archetype of the people today"> | |
| <meta name="author" content="Alexandra Freitas"> | |
| <link rel="stylesheet" href="style.css"> | |
| <link rel="icon" type="image/png" href="https://i.imgur.com/B8KiTZ4.gif"> |