Skip to content

Instantly share code, notes, and snippets.

Vang Le biocyberman

  • Aalborg University
  • Aalborg, Denmark
Block or report user

Report or block biocyberman

Hide content and notifications from this user.

Learn more about blocking users

Contact Support about this user’s behavior.

Learn more about reporting abuse

Report abuse
View GitHub Profile
@zetas
zetas / default.json
Created Jun 13, 2018
iTerm2 Byobu Keybind Profile.
View default.json
{
"Ansi 5 Color" : {
"Green Component" : 0.4117647111415863,
"Blue Component" : 0.78823530673980713,
"Red Component" : 0.55686277151107788
},
"Working Directory" : "\/Users\/david",
"Prompt Before Closing 2" : 0,
"Selected Text Color" : {
"Green Component" : 0.729411780834198,
@joffilyfe
joffilyfe / README.md
Last active Jul 21, 2019
GITEA + Drone (0.7|0.8)
View README.md

Compose file to setup and host a Gitea and Drone environment

This environment is dependent off a common network for docker/git plugin and gitea-server, so for this work fine in closed networks we have to create a custom network before run this composefile.

First create your network:

docker network create gitea-network
View emacs-25.1-24bit.diff
diff --git lisp/term/xterm.el lisp/term/xterm.el
index 19eb37a..6298d88 100644
--- lisp/term/xterm.el
+++ lisp/term/xterm.el
@@ -917,6 +917,15 @@ versions of xterm."
;; are more colors to support, compute them now.
(when (> ncolors 0)
(cond
+ ((= (display-color-cells (selected-frame)) 16777216) ; 24-bit xterm
+ (let ((idx (length xterm-standard-colors)))
@webgefrickel
webgefrickel / vim.sh
Created Apr 26, 2016
Compiling vim on Ubuntu 16 with LUA-support
View vim.sh
# Remove previous installations
sudo apt-get remove vim vim-runtime vim-tiny vim-common
# Install dependencies
sudo apt-get install libncurses5-dev python-dev libperl-dev ruby-dev liblua5.2-dev
# Fix liblua paths
sudo ln -s /usr/include/lua5.2 /usr/include/lua
sudo ln -s /usr/lib/x86_64-linux-gnu/liblua5.2.so /usr/local/lib/liblua.so
View btrfs-undelete
#!/bin/bash
# btrfs-undelete
# Copyright (C) 2013 Jörg Walter <info@syntax-k.de>
# This program is free software; you can redistribute it and/or modify it under
# the term of the GNU General Public License as published by the Free Software
# Foundation; either version 2 of the License, or any later version.
if [ ! -b "$1" -o -z "$2" -o -z "$3" ]; then
echo "Usage: $0 <dev> <file/dir> <dest>" 1>&2
echo
View Makefile
####################
# Makefile
# Copyright Brian A. Fannin 2015
####################
RDIR = .
DATA_DIR = $(RDIR)/data
GATHER_DIR = $(DATA_DIR)/gather
GATHER_SOURCE = $(wildcard $(GATHER_DIR)/*.Rmd)
@steakknife
steakknife / array_slicing_and_compaction.advanced.bash
Last active Jul 20, 2019
Advanced Bash :: Array slicing and compaction in bash
View array_slicing_and_compaction.advanced.bash
# Advanced Bash :: Array slicing and compaction in bash
# TL;DR
X=(something 'whatever' "i have more S P A C E S than i can give away. arent you jealous?")
# ${X[@]} the usual whole array
# ${X[@]:index:length} slice from index to index+length-1 inclusive
# ${X[@]::length} slice from 0 to length-1 inclusive
# ${X[@]:index} slice from index to end of array inclusive
@mtw
mtw / bam2fastq_cutadapt.sh
Last active Feb 7, 2017
Raw NGS data is often shipped as unaligned BAM files. This shell script converts raw reads to FASTQ format and trims Illumina adapters with cutadapt. Quality Control is performed with FastQC.
View bam2fastq_cutadapt.sh
#!/bin/bash
cutadapt=`which cutadapt`
fastqc=`which fastqc`
bam2fastq=`which bam2fastq`
gzip=`which gzip`
origdir="."
results="cutadapt"
fastqcdir="${results}/FastQC"
adapter5="CTACACTCTTTCCCTACACGACGCTCTTCCGATCT"
View onchange.sh
#!/bin/bash
#
# Watch current directory (recursively) for file changes, and execute
# a command when a file or directory is created, modified or deleted.
#
# Written by: Senko Rasic <senko.rasic@dobarkod.hr>
#
# Requires Linux, bash and inotifywait (from inotify-tools package).
#
# To avoid executing the command multiple times when a sequence of
@ScottPhillips
ScottPhillips / .htaccess
Created Feb 2, 2012
Common .htaccess Redirects
View .htaccess
#301 Redirects for .htaccess
#Redirect a single page:
Redirect 301 /pagename.php http://www.domain.com/pagename.html
#Redirect an entire site:
Redirect 301 / http://www.domain.com/
#Redirect an entire site to a sub folder
Redirect 301 / http://www.domain.com/subfolder/
You can’t perform that action at this time.