Daniel C. Jones dcjones
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| const line_width = 60 | |
| const alu = strcat( | |
| "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG", | |
| "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA", | |
| "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT", | |
| "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA", | |
| "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG", | |
| "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC", |
dcjones
/ Gadfly 0.3.0.ipynb
Created
June 20, 2014 22:08
Sorry, something went wrong. Reload?
Sorry, we cannot display this file.
Sorry, this file is invalid so it cannot be displayed.
dcjones
/ Gadfly 0.3.0.ipynb
Created
June 20, 2014 22:21
Sorry, something went wrong. Reload?
Sorry, we cannot display this file.
Sorry, this file is invalid so it cannot be displayed.
dcjones
/ Gadfly -- JuliaCon 2014.ipynb
Created
June 24, 2014 05:42
Sorry, something went wrong. Reload?
Sorry, we cannot display this file.
Sorry, this file is invalid so it cannot be displayed.
dcjones
/ Brettel's Algorithm -- Not so good.ipynb
Created
July 10, 2014 16:58
Sorry, something went wrong. Reload?
Sorry, we cannot display this file.
Sorry, this file is invalid so it cannot be displayed.
dcjones
/ Distinguishable Colors.ipynb
Created
July 19, 2014 22:40
Sorry, something went wrong. Reload?
Sorry, we cannot display this file.
Sorry, this file is invalid so it cannot be displayed.
dcjones
/ Bio.Seq Overview.ipynb
Created
July 28, 2014 06:20
Sorry, something went wrong. Reload?
Sorry, we cannot display this file.
Sorry, this file is invalid so it cannot be displayed.
dcjones
/ contours_error.jl
Created
September 7, 2014 18:19
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| x=[ -1.2 | |
| -1.19868 | |
| -1.1947 | |
| -1.18809 | |
| -1.17886 | |
| -1.16703 | |
| -1.15263 | |
| -1.1357 | |
| -1.11627 |
dcjones
/ gist:e2b789392ff8b3564607
Created
April 10, 2015 18:28
Trying out https://github.com/kjenova/fogsaa with Bio.Seq
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| # Note: This only works on julia-0.4 currently. | |
| using Bio.Seq | |
| include("fogsaa.jl") | |
| scoring = AlignmentScoring(2, -1, -3, -1) | |
| FOGSAA( | |
| dna"AACGTACGTACAATAGTTTTACGATAACCGATAGCGATACCCATTAGACTATA", |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| function main() | |
| if length(ARGS) < 2 | |
| println(STDERR, "Usage: fastq_rnd_seek_proper.jl filename numsamples") | |
| exit() | |
| end | |
| filename = ARGS[1] | |
| numsamples = parse(Int, ARGS[2]) | |
| pattern = r"@.+[\n\r]+[A-Z-]+[\n\r]+\+[\n\r]+.+[\n\r]{0,1}" |
OlderNewer