Skip to content

Instantly share code, notes, and snippets.

@citadelculture
citadelculture / MANIFEST.sha256
Created September 7, 2026 21:48
dynamic-unl-scoring @ f18e6b4: unknown PFTL_NETWORK silently signs with devnet NetworkID (red/green harness, task_698a972a)
a1803951d1478e87021ba4504d2595561fa00a61496755f0136942a5da495771 REPORT.md
6e7c035ad579fd494ba901b8fb576560afe1d4fcb2d59abad6ff97e2f42068cf baseline-full-suite-f18e6b4.txt
eab74a7f0fd31cddd40dd64d4d4dc2ccbec111e7e9adc0510cf032c1a1537141 consumers.txt
e6214efed8fd7b96a134e958d96f3c5864bfe52d25b3618ef6fb161367f376f3 guard.patch
a7e23afb37e2fe9ccf7495dcb385682986a3cb34b2c1e591731e15eec008b109 test_pftl_network_guard.py
f3851cf27b44030dc47288570d747e7a089061c2c0166b1437391c36b6b17f37 transcript-green.txt
12f5cab676afa20baedf762c123c1f5b3ffe2fd8985041d622f83fd1abcfd9b0 transcript-red.txt
@jdnova0802
jdnova0802 / velaru_tcb_commit.json
Created September 7, 2026 21:47
Velaru TCB commit anchor POLLOCK-1 — 152637638ce3eee7…
{
"velaru_tcb_commit_anchor": true,
"pollock_rail": "POLLOCK-1",
"protocol": "tcb-commit-reveal-v1",
"receipt_hash": "152637638ce3eee735c4a66a1d845f99ad4f62abf3f4087c478bee4ea73a4606",
"action_not_taken": "policy_bind",
"decision_reason_hash": "dccb9b1a25673dea54cf98191bb052007da5d26c907269f1bf6dfa1ba8ec0f7a",
"handler_receipt_id": null,
"domain": "insurance",
"committed_at": "2026-09-07T21:47:57.759727Z",
@csh1668
csh1668 / metadata.json
Created September 7, 2026 21:47
RimWorld AutoTranslation Cache - Turkish (Google)
{"targetLanguage":"Turkish","translatorName":"Google","translatorModel":"Google","date":"2026-09-08 00:47:32","translationCount":321}
@pintumanisha2
pintumanisha2 / 1700-posts-mpesb-group-3-sub-engine-recruitment-2026.md
Created September 7, 2026 21:47
[1700 Posts] MPESB Group 3 Sub Engineer Recruitment 2026: Apply Online & Category Breakdown — Rojgar Suvidha Govt Job Alert

[1700 Posts] MPESB Group 3 Sub Engineer Recruitment 2026: Apply Online & Category Breakdown

Why This Matters

For engineering graduates and diploma holders living in Tier-2 and Tier-3 cities across Madhya Pradesh and neighboring regions, the local job market often presents a frustrating bottleneck. Private sector opportunities with decent pay scales are heavily concentrated in metro hubs like Bengaluru, Pune, or Gurugram, forcing widespread displacement and high living costs. When a state-level recruitment drive drops 1700 vacancies for Sub Engineers through the Madhya Pradesh Employee Selection Board (MPESB), it changes the economic arithmetic for hundreds of households outside the big tech corridors.

Securing a stable, government engineering role locally isn't just about escaping the volatile private contract cycle; it means retaining purchasing power within smaller hometowns where the cost of living is manageable. A Sub Engineer position provides institutional authority, structured career progressio

@1m9btabowh12
1m9btabowh12 / Persona 3 Reload.md
Created September 7, 2026 21:46
Persona 3 Reload For PC Latest 2026

Imagine stepping into a school year that hides a chilling secret, where the mundane transforms into a dark battle against inner demons. This Japanese RPG plunges players into the life of a transfer student at Gekkoukan High, where the Dark Hour unveils a towering dungeon called Tartarus. The game intricately blends stylish anime visuals with a somber tone, balancing school life with an underlying sense of dread and urgency. Players engage in daily activities—like attending classes, building relationships, and improving social stats—while nights are reserved for exploring Tartarus, filled with Shadows and formidable bosses.

Turn-based battles challenge players to exploit enemy weaknesses, leading to powerful All-Out Attacks, and a robust Persona fusion system allows for creative character development. Enhanced by modern features like direct party control and refined dungeon navigation, this installment revamp

@baobabprince
baobabprince / DB39.359_microbiome_data.csv
Created September 7, 2026 21:46
Microbiome data for sample: DB39.359 . ASV column represent the sequence of specific bacteria. than there is the Taxonomic levels names. and the prevelance of specific bacteria in your gut and in the healthy population in israel. For further information about each bacteria, the last column contains a link to dbBact, showing information where the…
We can make this file beautiful and searchable if this error is corrected: Unclosed quoted field in line 3.
"Kingdom","Phyla","Class","Order","Family","Genus","Species","You","Population","ASV","link"
"k__Bacteria"," p__Bacteroidetes"," c__Bacteroidia"," o__Bacteroidales"," f__Bacteroidaceae"," g__Bacteroides"," s__",0.135061130922058,0.018058120571155,"TACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCGGGTTGTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGCGACCTTGAGTGCAACAGAGGTAGGCGGAATTCGTGG","http://dbbact.org/search_results?sequence=TACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCGGGTTGTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGCGACCTTGAGTGCAACAGAGGTAGGCGGAATTCGTGG"
"k__Bacteria"," p__Bacteroidetes"," c__Bacteroidia"," o__Bacteroidales"," f__Bacteroidaceae"," g__Bacteroides"," s__",0.100292919001528,0.0679883049376889,"TACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGATGGATGTTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGATATCTTGAGTGCAGTTGAGGCAGGCGGAATTCGTGG","http://dbbact.org/search_results?sequence=TACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGATGGATGTTTAAGTCAGTTGTGAAAGT
@choco-bot
choco-bot / FilesSnapshot.xml
Created September 7, 2026 21:45
flyctl v0.4.100 - Passed - Package Tests Results
<?xml version="1.0" encoding="utf-8"?>
<fileSnapshot xmlns:xsd="http://www.w3.org/2001/XMLSchema" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance">
<files>
<file path="C:\ProgramData\chocolatey\lib\flyctl\flyctl.nupkg" checksum="E9CC668BFBB8778CEA371C75CD3BA82F" />
<file path="C:\ProgramData\chocolatey\lib\flyctl\flyctl.nuspec" checksum="1882F1BAFDDEF0B2406673197B6CE5F7" />
<file path="C:\ProgramData\chocolatey\lib\flyctl\flyctl_0.4.100_Windows_x86_64.zip.txt" checksum="8B04453421F833A7D3D1417CFF181232" />
<file path="C:\ProgramData\chocolatey\lib\flyctl\tools\chocolateyInstall.ps1" checksum="48699C3CEF34DC537621E56FE8447087" />
<file path="C:\ProgramData\chocolatey\lib\flyctl\tools\chocolateyUninstall.ps1" checksum="BCC5F2B41F4997AC990E673910ECBCA3" />
<file path="C:\ProgramData\chocolatey\lib\flyctl\tools\EnvPathFunctions-Custom.ps1" checksum="4129F40F04D136C2FF3B3763499D9D3F" />
<file path="C:\ProgramData\chocolatey\lib\flyctl\tools\Uninstall-ChocolateyPath-Custo
<!DOCTYPE html>
<html>
<head>
<meta charset='utf-8'>
<meta name='viewport' content='width=device-width'>
<title>Privacy Policy</title>
<style> body { font-family: 'Helvetica Neue', Helvetica, Arial, sans-serif; padding:1em; } </style>
</head>
<body>
<strong>Privacy Policy</strong><p>This privacy policy applies to the request! app for mobile devices, together with any related services operated by Eazy (collectively, the "Application"). Eazy is hereby referred to as the "Service Provider".</p><br><strong>Information Collection and Use</strong><p>The Application collects information when you download and use it. This information may include information such as</p><ul><li>Your device's Internet Protocol address</li><li>The pages of the Application that you visit, the time and date of your visit, the time spent on those pages</li><li>The time spent on the Application</li><li>your mobile operating system you use</li></ul><p></p><br><strong>Cookies and tracking technologie
@baobabprince
baobabprince / DB39.078_microbiome_data.csv
Created September 7, 2026 21:42
Microbiome data for sample: DB39.078 . ASV column represent the sequence of specific bacteria. than there is the Taxonomic levels names. and the prevelance of specific bacteria in your gut and in the healthy population in israel. For further information about each bacteria, the last column contains a link to dbBact, showing information where the…
We can make this file beautiful and searchable if this error is corrected: Unclosed quoted field in line 3.
"Kingdom","Phyla","Class","Order","Family","Genus","Species","You","Population","ASV","link"
"k__Bacteria"," p__Bacteroidetes"," c__Bacteroidia"," o__Bacteroidales"," f__Prevotellaceae"," g__Prevotella"," s__copri",0.252201457079506,0.0817725952577073,"TACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGGAGATTAAGCGTGTTGTGAAATGTAGATGCTCAACATCTGAACTGCAGCGCGAACTGGTTTCCTTGAGTACGCACAAAGTGGGCGGAATTCGTGG","http://dbbact.org/search_results?sequence=TACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGGAGATTAAGCGTGTTGTGAAATGTAGATGCTCAACATCTGAACTGCAGCGCGAACTGGTTTCCTTGAGTACGCACAAAGTGGGCGGAATTCGTGG"
"k__Bacteria"," p__Bacteroidetes"," c__Bacteroidia"," o__Bacteroidales"," f__Bacteroidaceae"," g__Bacteroides"," s__uniformis",0.135254988913525,0.036157248010867,"TACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCGGACGCTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGGTGTCTTGAGTACAGTAGAGGCAGGCGGAATTCGTGG","http://dbbact.org/search_results?sequence=TACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCGGACGCTTAAGT
This file has been truncated, but you can view the full file.
# Solve.mjs Log - 2026-09-07T20:23:07.408Z
[2026-09-07T20:23:07.419Z] [INFO] 📁 Log file: /home/box/solve-2026-09-07T20-23-07-406Z.log
[2026-09-07T20:23:07.427Z] [INFO] (All output will be logged here)
[2026-09-07T20:23:10.755Z] [INFO]
[2026-09-07T20:23:10.764Z] [INFO] 🚀 solve v2.22.0
[2026-09-07T20:23:10.770Z] [INFO] 🔧 Raw command executed:
[2026-09-07T20:23:10.778Z] [INFO] /home/box/.nvm/versions/node/v20.20.2/bin/node /home/box/.bun/bin/solve https://github.com/link-assistant/hive-mind/pull/2204 --think high --tool claude --attach-logs --verbose --no-tool-check --disable-report-issue --language en
[2026-09-07T20:23:10.783Z] [INFO]