This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
# -*- coding: utf-8 -*- | |
# Run with: scrapy crawl test1 -o test1.json | |
import scrapy | |
class IgemItem(scrapy.Item): | |
year = scrapy.Field() | |
title = scrapy.Field() | |
subtitle = scrapy.Field() | |
description = scrapy.Field() |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
CLUSTAL O(121) multiple sequence alignment | |
LifeTech GCCACCATGGCCCAAGTGATCAACACCAACAGCCTGAGCCTGATCACCCAGAACAACATC | |
Slovenia ------atggcacaagtcattaataccaacagcctctcgctgatcactcaaaataatatc | |
***** ***** ** ** *********** ******** ** ** ** *** | |
LifeTech AACAAGAACCAGAGCGCCCTGAGCAGCAGCATCGAGAGACTGAGCAGCGGCCTGAGAATC | |
Slovenia aacaagaaccagtctgcgctgtcgagttctatcgagcgtctgtcttctggcttgcgtatt | |
************ ** *** ** ****** * *** *** ** * ** |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
CLUSTAL O(1.2.1) multiple sequence alignment | |
IDT ------ATGGCACAGGTCATTAATACTAATAGTCTGAGTCTGATCACTCAGAATAACATC | |
LifeTech GCCACCATGGCCCAAGTGATCAACACCAACAGCCTGAGCCTGATCACCCAGAACAACATC | |
JCAT ------ATGGCCCAGGTGATCAACACCAACAGCCTGAGCCTGATCACCCAGAACAACATC | |
*****.**.** ** ** ** ** ** ***** ******** ***** ****** | |
IDT AACAAAAACCAATCAGCCCTGTCAAGTTCCATAGAGAGGCTGAGTAGCGGACTGAGGATA | |
LifeTech AACAAGAACCAGAGCGCCCTGAGCAGCAGCATCGAGAGACTGAGCAGCGGCCTGAGAATC |
This file has been truncated, but you can view the full file.
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
{ | |
"cells": [ | |
{ | |
"cell_type": "markdown", | |
"metadata": {}, | |
"source": [ | |
"Kruschke in PyMC3\n", | |
"=========\n", | |
"\n", | |
"Based on https://github.com/aloctavodia/Doing_bayesian_data_analysis with minor edits." |
This file has been truncated, but you can view the full file.
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
{ | |
"cells": [ | |
{ | |
"cell_type": "markdown", | |
"metadata": {}, | |
"source": [ | |
"Fancy Bayesian Linear Regression\n", | |
"=================\n", | |
"Take some data and regress a few different ways." | |
] |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
import pandas as pd | |
def expo(x, y): | |
return pd.DataFrame([[x, y, x**y]], columns=['x', 'y', 'x^y']) | |
def in_parallel(fn, loops=None, is_product=False, num_workers=8, *args, **kwargs): | |
from warnings import warn | |
from dask import compute, delayed | |
from itertools import product | |
import pandas as pd |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
"""Use Whisper and llama3 to transcribe and summarize a podcast. | |
""" | |
from pathlib import Path | |
import modal | |
from modal import Image, App, method | |
LOCAL_OUT = REMOTE_OUT = "./out/podcast_summarize" | |
GPU = modal.gpu.A10G() |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
<html style="background:black;width:30000px"><span style="font-family:monospace; color: green;">ESM3_GFP </span><span style="font-family:monospace; color: green;">M</span><span style="font-family:monospace; color: green;">S</span><span style="font-family:monospace; color: green;">K</span><span style="font-family:monospace; color: red;">V</span><span s |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
name | country | sex | DOB | age | height | weight | event | |
---|---|---|---|---|---|---|---|---|
Usain Bolt | JAM | M | 1986-08-21 | 30.02 | 1.96 | 95.0 | 100m | |
Margaret Nyairera Wambui | KEN | F | 1995-09-15 | 20.95 | 1.71 | 66.0 | 800m | |
Shadrack Kipchirchir | USA | M | 1989-02-22 | 27.52 | 1.73 | 53.0 | 10,000m | |
Alia Saeed Mohammed | UAE | F | 1993-11-13 | 22.79 | 1.58 | 54.0 | 10,000m | |
Alice Aprot Nawowuna | KEN | F | 1994-01-02 | 22.65 | 1.52 | 54.0 | 10,000m | |
Andrew Vernon | GBR | M | 1986-01-07 | 30.64 | 1.82 | 71.0 | 10,000m | |
Bedan Karoki Muchiri | KEN | M | 1990-08-21 | 26.02 | 1.7 | 54.0 | 10,000m | |
Ben St Lawrence | AUS | M | 1981-11-07 | 34.81 | 1.79 | 65.0 | 10,000m | |
Beth Potter | GBR | F | 1991-12-27 | 24.67 | 1.7 | 51.0 | 10,000m |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
name | sex | height | weight | |
---|---|---|---|---|
Alexandrova Ekaterina | F | 1.75 | 69 | |
Andreescu Bianca | F | 1.7 | 67 | |
Anisimova Amanda | F | 1.8 | 71 | |
Azarenka Victoria | F | 1.83 | 72 | |
Badosa Paula | F | 1.8 | 71 | |
Begu Irina-Camelia | F | 1.81 | 71 | |
Bencic Belinda | F | 1.75 | 69 | |
Bogdan Ana | F | 1.71 | 67 | |
Bondar Anna | F | 1.72 | 68 |