strace -e 'trace=!read,write' -p <pid>
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
// requires dependency on rustix | |
// rustix = { version = "0.37.1", features = ["fs"] } | |
#[cfg(test)] | |
mod tests { | |
use rustix::{fd::AsFd, fs::FallocateFlags}; | |
use std::{ | |
env, | |
fs::{File, OpenOptions}, | |
io::{Read, Seek, SeekFrom, Write}, |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
# Create an UpSet plot given the counts for each intersection. | |
# | |
# The input is a data frame with N + 1 columns, where N is the | |
# number of sets, and M rows, where M is the number of intersections | |
# between the sets. The values in columns 1:N are binary values | |
# indicating which sets are involved in each intersection. The | |
# N+1 column must have the name "count" and holds the count values | |
# for the intersections. You can generate a template counts data | |
# frame using the create_counts_df() function. | |
# |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
{ | |
"class": "CommandLineTool", | |
"inputs": [ | |
{ | |
"type": { | |
"type": "record", | |
"fields": [ | |
{ | |
"type": "File", | |
"format": "http://example.com/format1", |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
```cwl | |
#!/usr/bin/env cwl-runner | |
cwlVersion: v1.2 | |
class: CommandLineTool | |
inputs: | |
- id: reference | |
type: string |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
foo |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
from enum import IntFlag | |
import functools | |
import itertools | |
import operator | |
from ngsindex.utils import DefaultDict | |
from typing import ( | |
Generic, Iterable, Iterator, Optional, Sequence, Sized, Tuple, Type, TypeVar, Union, | |
cast | |
) |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
# Create an UpSet plot given the counts for each intersection. | |
# | |
# The input is a data frame with N + 1 columns, where N is the | |
# number of sets, and M rows, where M is the number of intersections | |
# between the sets. The values in columns 1:N are binary values | |
# indicating which sets are involved in each intersection. The | |
# N+1 column must have the name "count" and holds the count values | |
# for the intersections. You can generate a template counts data | |
# frame using the create_counts_df() function. | |
# |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
# This list was boostrapped from the FastQC contaminants.txt. | |
# TODO: add missing Illumina adapters from official list at: | |
# http://support.illumina.com/downloads/illumina-customer-sequence-letter.html | |
>IlluminaSingleEndAdapter1 | |
GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG | |
>IlluminaSingleEndAdapter2 | |
CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT | |
>IlluminaSingleEndPCRPrimer1 | |
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
<?xml version="1.0" encoding="utf-8"?> | |
<style xmlns="http://purl.org/net/xbiblio/csl" class="in-text" version="1.0" demote-non-dropping-particle="sort-only" default-locale="en-US"> | |
<info> | |
<title>National Library of Medicine (grant proposals with PMCID/PMID) - Author, Year</title> | |
<title-short>NLMAuthorYear</title-short> | |
<id>http://www.zotero.org/styles/national-library-of-medicine-grant-proposals</id> | |
<link href="http://www.zotero.org/styles/national-library-of-medicine-grant-proposals" rel="self"/> | |
<link href="http://www.nlm.nih.gov/pubs/formats/recommendedformats1991-full.pdf" rel="documentation"/> | |
<link href="http://publicaccess.nih.gov/citation_methods.htm" rel="documentation"/> | |
<link href="http://grants.nih.gov/grants/funding/424/SF424_RR_Guide_General_Adobe_VerC.pdf" rel="documentation"/> |
NewerOlder