Kelly Robinson kellyrob99
kellyrob99
/ DNAtoRNA
Created
October 16, 2011 22:03
BioGroovy 'Hello World' updated for v3.0.2 of BioJava
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| @GrabResolver(name='biojava', root='http://www.biojava.org/download/maven/') | |
| @Grab('org.biojava:biojava3-core:3.0.2') | |
| import org.biojava3.core.sequence.*; | |
| rna = new DNASequence("atgccgaatcgtaa").RNASequence | |
| println rna |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| @GrabResolver(name='biojava', root='http://www.biojava.org/download/maven/') | |
| @Grab('org.biojava:biojava3-core:3.0.2') | |
| import org.biojava3.core.sequence.* | |
| import org.biojava3.core.sequence.io.* | |
| import org.biojava3.core.sequence.compound.* | |
| def testFasta = '''> seq1 This is the description of my first sequence. | |
| AGTACGTAGTAGCTGCTGCTACGTGCGCTAGCTAGTACGTCA | |
| CGACGTAGATGCTAGCTGACTCGATGC | |
| > seq2 This is a description of my second sequence. |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| @GrabResolver(name='biojava', root='http://www.biojava.org/download/maven/') | |
| @Grab('org.biojava:biojava3-core:3.0.2') | |
| import org.biojava3.core.sequence.*; | |
| rna = new DNASequence(args? args[0] : '').RNASequence | |
| println rna |
kellyrob99
/ charSetDetector.gradle
Created
October 21, 2011 07:23
CharsetDetector task for Gradle, utilizes juniversalchardet
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| import org.mozilla.universalchardet.UniversalDetector | |
| buildscript { | |
| repositories { | |
| mavenCentral() | |
| } | |
| dependencies { | |
| classpath files('juniversalchardet-1.0.3.jar') // not available in public repository :( | |
| } | |
| } |
kellyrob99
/ build.gradle
Created
November 27, 2011 23:20
— forked from glaforge/build.gradle
build.gradle for setting up a new gradle-based project
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| apply plugin:'groovy' | |
| apply plugin:'idea' | |
| apply plugin:'project-report' | |
| apply plugin:'maven' | |
| repositories { | |
| mavenLocal() | |
| mavenCentral() | |
| } |
kellyrob99
/ jenkinsSVNVersionChecker.groovy
Created
December 4, 2011 18:03
A script to find the source control version of the last successful build on every Jenkins job for a particular server. Outputs whether or not each job is building the expectedVersion.
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| import groovy.json.JsonSlurper | |
| assert args && args.size() == 2 | |
| def urls = args[0].split(',') | |
| def expectedVersion = args[1] | |
| urls.each { url -> | |
| println "examining url $url" | |
| def json = new JsonSlurper().parseText(url.toURL().text) | |
| json.jobs.each { |
kellyrob99
/ jenkinsBuildArtifacts.groovy
Created
December 4, 2011 18:07
Example of parsing out the artifacts of the last successful build on Jenkins/Hudson using the JSON api
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| import groovy.json.* | |
| def HOSTNAME = 'http://ci.jruby.org' | |
| def JOBNAME = 'jruby-dist' | |
| def JOB_URL = "$HOSTNAME/job/$JOBNAME/lastSuccessfulBuild" | |
| def text = "$JOB_URL/api/json".toURL().text | |
| println JsonOutput.prettyPrint(text) | |
| def json = new JsonSlurper().parseText(text) | |
| json.artifacts.each{ | |
| println it | |
| } |
kellyrob99
/ openCsv.groovy
Created
December 4, 2011 18:35
OpenCSV in a groovy script to read in a file, filter the content and write out the result
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| @Grab(group = 'net.sf.opencsv', module = 'opencsv', version = '2.3') | |
| import au.com.bytecode.opencsv.CSVReader | |
| import au.com.bytecode.opencsv.CSVParser | |
| import au.com.bytecode.opencsv.CSVWriter | |
| def TEST_FILE_NAME = 'test.csv' | |
| def TEST_OUTPUT_FILE_NAME = 'testOut.csv' | |
| List<String[]> rows = new CSVReader(new FileReader(new File(TEST_FILE_NAME)), CSVParser.DEFAULT_SEPARATOR, CSVParser.DEFAULT_ESCAPE_CHARACTER, CSVParser.DEFAULT_QUOTE_CHARACTER, 1).readAll() | |
| def rowsOver100 = rows.findAll {it[1].toInteger() > 100} |
kellyrob99
/ grettyExample.groovy
Created
December 4, 2011 19:06
Gretty webserver example running on 8080, from http://www.ibm.com/developerworks/java/library/j-javadev2-20/index.html
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| import org.mbte.gretty.httpserver.* | |
| @GrabResolver(name='gretty', | |
| root='http://groovypp.artifactoryonline.com/groovypp/libs-releases-local') | |
| @Grab('org.mbte.groovypp:gretty:0.4.279') | |
| GrettyServer server = [] | |
| server.groovy = [ | |
| localAddress: new InetSocketAddress("localhost", 8080), | |
| defaultHandler: { |
kellyrob99
/ grettyGreenMailServer.groovy
Created
December 28, 2011 02:06
Use Gretty to provide a JSON front end for a GreenMail smtp test server
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| @GrabResolver(name = 'gretty', root = 'http://groovypp.artifactoryonline.com/groovypp/libs-releases-local') | |
| @Grab('org.mbte.groovypp:gretty:0.4.279') | |
| @Grab('com.icegreen:greenmail:1.3.1b') | |
| import javax.mail.internet.MimeMessage | |
| import org.jboss.netty.channel.local.LocalAddress | |
| import org.mbte.gretty.httpserver.GrettyServer | |
| import com.icegreen.greenmail.user.* | |
| import com.icegreen.greenmail.util.* | |
| //create the greenmail server |