bowtie test

comic-test

$ docker run --rm -v $(pwd)/data2:/data comics/bowtie2 wgsim -e 0 -N 10000 -1 300 -2 300 -r 0 -R 0 /data/s_cerevisiae.fa /data/sample_seq_1.fastq /data/sample_seq_2.fastq
[wgsim] seed = 1524818001
[wgsim_core] calculating the total length of the reference sequence...
[wgsim_core] 18 sequences, total length: 12162995

$ ls -alh data2
total 25M
drwxr-xr-x 2 alper alper 4.0K Apr 27 11:32 .
drwxr-xr-x 4 alper alper 4.0K Apr 27 11:31 ..
-rw-r--r-- 1 root  root  6.2M Apr 27 11:33 sample_seq_1.fastq
-rw-r--r-- 1 root  root  6.2M Apr 27 11:33 sample_seq_2.fastq
-rw-r--r-- 1 alper alper  12M Apr 27 11:31 s_cerevisiae.fa

$ head GCF_000001405.38_GRCh38.p12_genomic.fna
>NC_000001.11 Homo sapiens chromosome 1, GRCh38.p12 Primary Assembly
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

Eğer yukarıdaki komut da hata verirse, h.sapiens_seq_1.fastq dosyasının ilk 12 satırını bastırıp buraya yapıştırabilir misniz? Notepad kullanmanıza gerek yok, powershell'de GetContent tarzı bir komut vardı. Şu şekilde olması lazım:

Get-Content "A:\Homosapiens\h.sapiens_seq_1.fastq" | select -First 12

docker run --rm -v A:\Homosapiens:/data comics/bowtie2 bowtie2 -x /data/hg18 -U /data/h.sa
piens_seq_1.fastq -S data/output1.sam
(ERR): bowtie2-align died with signal 9 (KILL)

Get-Content "A:\Homosapiens\h.sapiens_seq_1.fastq" | select -First 12
@NC_000001.11_206842949_206843401_0:0:0_0:0:0_0/1
TTTTCTGAATAAATTCCATATTTTACCTATGAATGGAAGGATCTTTTCATTCAGGGAGAGTCAGTCAAGACTGAGGACAGGGTGTTTCTGACAGAGGGATGGTTGTCATGGTGACAAAGCTGAACAAGCACAGACACAAGTAAGTAGAGAGGCCACTGGGTAGAGAGGCTGAAAAGGGTACCAACATCTAGATGGACACTGCATAGATGATTCAGAGCACAAATGTGTATCTTTCAGATTTCATATCACATGCTTTAATGGAAAGAACAAGACCTCTGAAGTCCAATTGATCTGGTTCCA
+
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
@NC_000001.11_206836024_206836525_0:0:0_0:0:0_1/1
TGCCAAGCTGCCCTCTACCTTTGGCTTCTTCCCCTAGCTCCTTATTGTGGCTAATTAGTTCTTGAAGATGCCTTGTGCCTCCCTTTCCCATCTCTCCAGAAGGTGAAATCTCCACAGCTGGCTTCAAACAAATGATTTTAAGCAGATACACTCTTGAGGTTTATAATAAAAGGGTGTTACTTATTTCAGGGGCAAACATCAAAAACCAAGTGTGTTTTTATGGTTTTTCACATCTGTTGCCGAATTCCTAGGGCATCTTACCAACCCTGCTTTTCCTATTTAATTTATTAAAAACAATGC
+
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII
@NC_000001.11_196522359_196522901_0:0:0_0:0:0_2/1
ATTTTACAGAGCACTGATTGGTCCATTTTACAGAGTGCTGATTGGTCCATTTTACAGAGTGCTGATTGGTGCATTTACAATCCTTTACCTAGACACAACATGCTGATTAGTGCGTTTTTTACAGAGTGCTGATTGGTGCATTTACAATCCTTTAGCTAGACACATAGTGCTGATTGCTGCGTTTTTACAGAGTGCTGACTGGTGCATTCACAATCCTTTAGCTAGACACAGAGCACTGATTGGTGCGTTTACAGTCCTCTAGCTAGACAGAAAAGTTCTCTAAGTCCCCACTCGACCCAG
+
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII

son bir deneme de şöyle birşey olabilir. A:\Homosapiens klasörü içine raw_test.txt adlı bir dosya kaydedin, Notepad kullanarak, içindekiler de 3 satırda 3 dizi olacak şekilde olsun:

TTTTCTGAATAAATTCCATATTTTACCTATGAATGGAAGGATCTTTTCATTCAGGGAGAGTCAGTCAAGACTGAGGACAGGGTGTTTCTGACAG
TGCCAAGCTGCCCTCTACCTTTGGCTTCTTCCCCTAGCTCCTTATTGTGGCTAATTAGTTCTTGAAGATGCCTTGTGCCTCCCTTTCCCATCT
ATTTTACAGAGCACTGATTGGTCCATTTTACAGAGTGCTGATTGGTCCATTTTACAGAGTGCTGATTGGTGCATTTACAATCCTTTACCTAGAC

daha sonra da aşağıdaki komutu çalıştırın:

docker run --rm -v A:\Homosapiens:/data comics/bowtie2 bowtie2 -x /data/hg18 -U /data/raw_test.txt -r -S data/output1.sam

-r opsiyonuna dikkat edin

docker run --rm -v A:\Homosapiens:/data comics/bowtie2 bowtie2 -x /data/hg18 -U /data/raw_
test.txt -r -S data/output1.sam
(ERR): bowtie2-align died with signal 9 (KILL)

bir de -r opsiyonunu kaldırıp çalıştırabilir misiniz?

docker run --rm -v A:\Homosapiens:/data comics/bowtie2 bowtie2 -x /data/hg18 -U /data/raw_
test.txt -S data/output1.sam
(ERR): bowtie2-align died with signal 9 (KILL)

bakteri için bowtie çalıştı demiştiniz di mi, o komutu tekrar çalıştırıp çıktısını gönderebilir misiniz?

-a---- 14.3.2018 22:37 30 Dockerfile
-a---- 16.3.2018 22:22 5741800 e_coli.1.bt2
-a---- 18.2.2009 12:40 1673519 e_coli.1.ebwt
-a---- 16.3.2018 22:22 1160420 e_coli.2.bt2
-a---- 18.2.2009 12:40 617372 e_coli.2.ebwt
-a---- 16.3.2018 22:22 17 e_coli.3.bt2
-a---- 18.2.2009 12:40 17 e_coli.3.ebwt
-a---- 16.3.2018 22:22 1160413 e_coli.4.bt2
-a---- 18.2.2009 12:40 1234730 e_coli.4.ebwt
-a---- 16.3.2018 19:17 4699745 e_coli.fna
-a---- 16.3.2018 22:23 5741800 e_coli.rev.1.bt2
-a---- 18.2.2009 12:40 1673519 e_coli.rev.1.ebwt
-a---- 16.3.2018 22:23 1160420 e_coli.rev.2.bt2
-a---- 18.2.2009 12:40 617372 e_coli.rev.2.ebwt
-a---- 16.3.2018 23:32 652451840 e_coli_seq_1.fastq
-a---- 16.3.2018 23:45 2052452005 e_coli_seq_10.fastq
-a---- 16.3.2018 23:32 652451840 e_coli_seq_2.fastq
-a---- 16.3.2018 23:35 952451802 e_coli_seq_3.fastq
-a---- 16.3.2018 23:35 952451802 e_coli_seq_4.fastq
-a---- 16.3.2018 23:39 1252452200 e_coli_seq_5.fastq
-a---- 16.3.2018 23:39 1252452200 e_coli_seq_6.fastq
-a---- 16.3.2018 23:42 1552452094 e_coli_seq_7.fastq
-a---- 16.3.2018 23:42 1552452094 e_coli_seq_8.fastq
-a---- 16.3.2018 23:45 2052452005 e_coli_seq_9.fastq
-a---- 18.2.2009 14:09 1262 make_e_coli.sh
-a---- 14.3.2018 23:53 476 memory.py

dosyalar bunlar 1 ve 2. fastqlar için sam oluşturuyorum.Hemen yollayacağım.

docker run --rm -v A:\e.coli:/data comics/bowtie2 bowtie2 -x /data/e_coli -1 /data/e_coli_seq_1.fastq -2 /
data/e_coli_seq_2.fastq -S data/output1.sam
1000000 reads; of these:
1000000 (100.00%) were paired; of these:
495539 (49.55%) aligned concordantly 0 times
493587 (49.36%) aligned concordantly exactly 1 time
10874 (1.09%) aligned concordantly >1 times
----
495539 pairs aligned concordantly 0 times; of these:
481897 (97.25%) aligned discordantly 1 time
----
13642 pairs aligned 0 times concordantly or discordantly; of these:
27284 mates make up the pairs; of these:
0 (0.00%) aligned 0 times
4361 (15.98%) aligned exactly 1 time
22923 (84.02%) aligned >1 times
100.00% overall alignment rate

-a---- 14.3.2018 22:37 30 Dockerfile
-a---- 16.3.2018 22:22 5741800 e_coli.1.bt2
-a---- 18.2.2009 12:40 1673519 e_coli.1.ebwt
-a---- 16.3.2018 22:22 1160420 e_coli.2.bt2
-a---- 18.2.2009 12:40 617372 e_coli.2.ebwt
-a---- 16.3.2018 22:22 17 e_coli.3.bt2
-a---- 18.2.2009 12:40 17 e_coli.3.ebwt
-a---- 16.3.2018 22:22 1160413 e_coli.4.bt2
-a---- 18.2.2009 12:40 1234730 e_coli.4.ebwt
-a---- 16.3.2018 19:17 4699745 e_coli.fna
-a---- 16.3.2018 22:23 5741800 e_coli.rev.1.bt2
-a---- 18.2.2009 12:40 1673519 e_coli.rev.1.ebwt
-a---- 16.3.2018 22:23 1160420 e_coli.rev.2.bt2
-a---- 18.2.2009 12:40 617372 e_coli.rev.2.ebwt
-a---- 16.3.2018 23:32 652451840 e_coli_seq_1.fastq
-a---- 16.3.2018 23:45 2052452005 e_coli_seq_10.fastq
-a---- 16.3.2018 23:32 652451840 e_coli_seq_2.fastq
-a---- 16.3.2018 23:35 952451802 e_coli_seq_3.fastq
-a---- 16.3.2018 23:35 952451802 e_coli_seq_4.fastq
-a---- 16.3.2018 23:39 1252452200 e_coli_seq_5.fastq
-a---- 16.3.2018 23:39 1252452200 e_coli_seq_6.fastq
-a---- 16.3.2018 23:42 1552452094 e_coli_seq_7.fastq
-a---- 16.3.2018 23:42 1552452094 e_coli_seq_8.fastq
-a---- 16.3.2018 23:45 2052452005 e_coli_seq_9.fastq
-a---- 18.2.2009 14:09 1262 make_e_coli.sh
-a---- 14.3.2018 23:53 476 memory.py
-a---- 29.4.2018 01:26 1518878609 output1.sam <------------------------

Çoğu ihtimali denedik ve görüldüğü kadarıyla:

• bowtie2 çalışıyor (ecoli)
• hg18 indeksinde sorun yok (bowtie2-inpect)
• fastq dosyalarında sorun yok (sorun olsa, fastq okunmuyor şeklinde hata mesajı vermesi lazım)

aklıma sadece bir ihtimal geliyor, insan genomu için eşleme yapılırken indeks hafızaya yükleniyor, yaklaşık 4 gb kadar RAM gerekiyor, acaba Windows'taki docker hafıza ile ilgili sorun mu yaşıyor diye merak ettim. Kendi bilgisayarımda docker'a az miktarda RAM ayırıp çalıştırdım ve hata mesajı verdi ama sizdeki hata mesajı ile aynı değil.
bowtie2 programının neden kapatıldığını bulmak için, Linux'ta strace diye bir program var çalışan programları takip ediyor, onu kullanabiliriz. Bu program da container içinde kurulu değil. O yüzden yeni bir image hazırladım. İlk önce bu image ile alignment deneyeiim:

docker run --rm -v A:\Homosapiens:/data alperyilmaz/bowtie2-samtools bowtie2 -x hg18 -1 h.sapiens_seq_1.fastq -2 h.sapiens_seq_2.fastq -S output1.sam

Bu komutu çalıştırıp çıktısını eklerseniz sevinirim.

not: bu image "working directory" olarak /data kullanıyor zaten, o yüzden dosyaları kullanırken ayrıca /data altında olduklarını belirtmeye gerek yok.

docker run --rm -v A:\Homosapiens:/data alperyilmaz/bowtie2-samtools bowtie2 -x hg18 -1 h.
sapiens_seq_1.fastq -2 h.sapiens_seq_2.fastq -S output1.sam
Killed
(ERR): bowtie2-align exited with value 137

Tamamdır.. şimdi aşağıdaki komutu çalıştıralim

docker run --security-opt seccomp:unconfined --rm -v A:\Homosapiens:/data alperyilmaz/bowtie2-samtools strace bowtie2 -x hg18 -1 h.sapiens_seq_1.fastq -2 h.sapiens_seq_2.fastq -S output1.sam

bu komutun çıktısı biraz uzun olacak, hepsini yapıştırabilirseniz güzel olur.

docker run --security-opt seccomp:unconfined --rm -v A:\Homosapiens:/data alperyilmaz/bowt
ie2-samtools strace bowtie2 -x hg18 -1 h.sapiens_seq_1.fastq -2 h.sapiens_seq_2.fastq -S output1.sam
execve("/usr/bin/bowtie2", ["bowtie2", "-x", "hg18", "-1", "h.sapiens_seq_1.fastq", "-2", "h.sapiens_seq_2.fastq", "-S", "output1.sam"], 0x7ffce0694450 /* 3 vars /) = 0
brk(NULL) = 0x55e68dd09000
access("/etc/ld.so.nohwcap", F_OK) = -1 ENOENT (No such file or directory)
access("/etc/ld.so.preload", R_OK) = -1 ENOENT (No such file or directory)
openat(AT_FDCWD, "/etc/ld.so.cache", O_RDONLY|O_CLOEXEC) = 3
fstat(3, {st_mode=S_IFREG|0644, st_size=10944, ...}) = 0
mmap(NULL, 10944, PROT_READ, MAP_PRIVATE, 3, 0) = 0x7f867a475000
close(3) = 0
access("/etc/ld.so.nohwcap", F_OK) = -1 ENOENT (No such file or directory)
openat(AT_FDCWD, "/lib/x86_64-linux-gnu/libc.so.6", O_RDONLY|O_CLOEXEC) = 3
read(3, "\177ELF\2\1\1\3\0\0\0\0\0\0\0\0\3\0>\0\1\0\0\0\260\34\2\0\0\0\0\0"..., 832) = 832
fstat(3, {st_mode=S_IFREG|0755, st_size=2030544, ...}) = 0
mmap(NULL, 8192, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_ANONYMOUS, -1, 0) = 0x7f867a473000
mmap(NULL, 4131552, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 3, 0) = 0x7f8679e60000
mprotect(0x7f867a047000, 2097152, PROT_NONE) = 0
mmap(0x7f867a247000, 24576, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 3, 0x1e7000) = 0x7f867a247000
mmap(0x7f867a24d000, 15072, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_ANONYMOUS, -1, 0) = 0x7f867a24d000
close(3) = 0
arch_prctl(ARCH_SET_FS, 0x7f867a474540) = 0
mprotect(0x7f867a247000, 16384, PROT_READ) = 0
mprotect(0x55e68c996000, 4096, PROT_READ) = 0
mprotect(0x7f867a478000, 4096, PROT_READ) = 0
munmap(0x7f867a475000, 10944) = 0
brk(NULL) = 0x55e68dd09000
brk(0x55e68dd2a000) = 0x55e68dd2a000
execve("/usr/local/sbin/perl", ["perl", "/usr/bin/bowtie2", "-x", "hg18", "-1", "h.sapiens_seq_1.fastq", "-2", "h.sapiens_seq_2.fastq", "-S", "output1.sam"], 0x7fff3e277b98 / 3 vars /) = -1 ENOENT (No such file or directory)
execve("/usr/local/bin/perl", ["perl", "/usr/bin/bowtie2", "-x", "hg18", "-1", "h.sapiens_seq_1.fastq", "-2", "h.sapiens_seq_2.fastq", "-S", "output1.sam"], 0x7fff3e277b98 / 3 vars /) = -1 ENOENT (No such file or directory)
execve("/usr/sbin/perl", ["perl", "/usr/bin/bowtie2", "-x", "hg18", "-1", "h.sapiens_seq_1.fastq", "-2", "h.sapiens_seq_2.fastq", "-S", "output1.sam"], 0x7fff3e277b98 / 3 vars /) = -1 ENOENT (No such file or directory)
execve("/usr/bin/perl", ["perl", "/usr/bin/bowtie2", "-x", "hg18", "-1", "h.sapiens_seq_1.fastq", "-2", "h.sapiens_seq_2.fastq", "-S", "output1.sam"], 0x7fff3e277b98 / 3 vars /) = 0
brk(NULL) = 0x557bfccc1000
access("/etc/ld.so.nohwcap", F_OK) = -1 ENOENT (No such file or directory)
access("/etc/ld.so.preload", R_OK) = -1 ENOENT (No such file or directory)
openat(AT_FDCWD, "/etc/ld.so.cache", O_RDONLY|O_CLOEXEC) = 3
fstat(3, {st_mode=S_IFREG|0644, st_size=10944, ...}) = 0
mmap(NULL, 10944, PROT_READ, MAP_PRIVATE, 3, 0) = 0x7fe77de15000
close(3) = 0
access("/etc/ld.so.nohwcap", F_OK) = -1 ENOENT (No such file or directory)
openat(AT_FDCWD, "/lib/x86_64-linux-gnu/libdl.so.2", O_RDONLY|O_CLOEXEC) = 3
read(3, "\177ELF\2\1\1\0\0\0\0\0\0\0\0\0\3\0>\0\1\0\0\0P\16\0\0\0\0\0\0"..., 832) = 832
fstat(3, {st_mode=S_IFREG|0644, st_size=14560, ...}) = 0
mmap(NULL, 8192, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_ANONYMOUS, -1, 0) = 0x7fe77de13000
mmap(NULL, 2109712, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 3, 0) = 0x7fe77d9ed000
mprotect(0x7fe77d9f0000, 2093056, PROT_NONE) = 0
mmap(0x7fe77dbef000, 8192, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 3, 0x2000) = 0x7fe77dbef000
close(3) = 0
access("/etc/ld.so.nohwcap", F_OK) = -1 ENOENT (No such file or directory)
openat(AT_FDCWD, "/lib/x86_64-linux-gnu/libm.so.6", O_RDONLY|O_CLOEXEC) = 3
read(3, "\177ELF\2\1\1\3\0\0\0\0\0\0\0\0\3\0>\0\1\0\0\0\200\272\0\0\0\0\0\0"..., 832) = 832
fstat(3, {st_mode=S_IFREG|0644, st_size=1700792, ...}) = 0
mmap(NULL, 3789144, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 3, 0) = 0x7fe77d64f000
mprotect(0x7fe77d7ec000, 2093056, PROT_NONE) = 0
mmap(0x7fe77d9eb000, 8192, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 3, 0x19c000) = 0x7fe77d9eb000
close(3) = 0
access("/etc/ld.so.nohwcap", F_OK) = -1 ENOENT (No such file or directory)
openat(AT_FDCWD, "/lib/x86_64-linux-gnu/libpthread.so.0", O_RDONLY|O_CLOEXEC) = 3
read(3, "\177ELF\2\1\1\0\0\0\0\0\0\0\0\0\3\0>\0\1\0\0\0000b\0\0\0\0\0\0"..., 832) = 832
fstat(3, {st_mode=S_IFREG|0755, st_size=144976, ...}) = 0
mmap(NULL, 2221184, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 3, 0) = 0x7fe77d430000
mprotect(0x7fe77d44a000, 2093056, PROT_NONE) = 0
mmap(0x7fe77d649000, 8192, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 3, 0x19000) = 0x7fe77d649000
mmap(0x7fe77d64b000, 13440, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_ANONYMOUS, -1, 0) = 0x7fe77d64b000
close(3) = 0
access("/etc/ld.so.nohwcap", F_OK) = -1 ENOENT (No such file or directory)
openat(AT_FDCWD, "/lib/x86_64-linux-gnu/libc.so.6", O_RDONLY|O_CLOEXEC) = 3
read(3, "\177ELF\2\1\1\3\0\0\0\0\0\0\0\0\3\0>\0\1\0\0\0\260\34\2\0\0\0\0\0"..., 832) = 832
fstat(3, {st_mode=S_IFREG|0755, st_size=2030544, ...}) = 0
mmap(NULL, 4131552, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 3, 0) = 0x7fe77d03f000
mprotect(0x7fe77d226000, 2097152, PROT_NONE) = 0
mmap(0x7fe77d426000, 24576, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 3, 0x1e7000) = 0x7fe77d426000
mmap(0x7fe77d42c000, 15072, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_ANONYMOUS, -1, 0) = 0x7fe77d42c000
close(3) = 0
access("/etc/ld.so.nohwcap", F_OK) = -1 ENOENT (No such file or directory)
openat(AT_FDCWD, "/lib/x86_64-linux-gnu/libcrypt.so.1", O_RDONLY|O_CLOEXEC) = 3
read(3, "\177ELF\2\1\1\0\0\0\0\0\0\0\0\0\3\0>\0\1\0\0\0P\r\0\0\0\0\0\0"..., 832) = 832
fstat(3, {st_mode=S_IFREG|0644, st_size=39208, ...}) = 0
mmap(NULL, 2322976, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 3, 0) = 0x7fe77ce07000
mprotect(0x7fe77ce10000, 2093056, PROT_NONE) = 0
mmap(0x7fe77d00f000, 8192, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 3, 0x8000) = 0x7fe77d00f000
mmap(0x7fe77d011000, 184864, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_ANONYMOUS, -1, 0) = 0x7fe77d011000
close(3) = 0
mmap(NULL, 8192, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_ANONYMOUS, -1, 0) = 0x7fe77de11000
arch_prctl(ARCH_SET_FS, 0x7fe77de11fc0) = 0
mprotect(0x7fe77d426000, 16384, PROT_READ) = 0
mprotect(0x7fe77d00f000, 4096, PROT_READ) = 0
mprotect(0x7fe77d649000, 4096, PROT_READ) = 0
mprotect(0x7fe77d9eb000, 4096, PROT_READ) = 0
mprotect(0x7fe77dbef000, 4096, PROT_READ) = 0
mprotect(0x557bfafb9000, 24576, PROT_READ) = 0
mprotect(0x7fe77de18000, 4096, PROT_READ) = 0
munmap(0x7fe77de15000, 10944) = 0
set_tid_address(0x7fe77de12290) = 6
set_robust_list(0x7fe77de122a0, 24) = 0
rt_sigaction(SIGRTMIN, {sa_handler=0x7fe77d435cb0, sa_mask=[], sa_flags=SA_RESTORER|SA_SIGINFO, sa_restorer=0x7fe77d442890}, NULL, 8) = 0
rt_sigaction(SIGRT_1, {sa_handler=0x7fe77d435d50, sa_mask=[], sa_flags=SA_RESTORER|SA_RESTART|SA_SIGINFO, sa_restorer=0x7fe77d442890}, NULL, 8) = 0
rt_sigprocmask(SIG_UNBLOCK, [RTMIN RT_1], NULL, 8) = 0
prlimit64(0, RLIMIT_STACK, NULL, {rlim_cur=81921024, rlim_max=RLIM64_INFINITY}) = 0
rt_sigaction(SIGFPE, {sa_handler=SIG_IGN, sa_mask=[FPE], sa_flags=SA_RESTORER|SA_RESTART, sa_restorer=0x7fe77d07df20}, {sa_handler=SIG_DFL, sa_mask=[], sa_flags=0}, 8) = 0
brk(NULL) = 0x557bfccc1000
brk(0x557bfcce2000) = 0x557bfcce2000
getuid() = 0
geteuid() = 0
getgid() = 0
getegid() = 0
openat(AT_FDCWD, "/dev/urandom", O_RDONLY) = 3
read(3, "\347\250G\375", 4) = 4
close(3) = 0
readlink("/proc/self/exe", "/usr/bin/perl", 4095) = 13
stat("/usr/lib/x86_64-linux-gnu/perl-base/5.26.1/x86_64-linux-gnu-thread-multi", 0x7ffe63a060c0) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl-base/5.26.1", 0x7ffe63a060c0) = -1 ENOENT (No such file or directory)
stat("/usr/local/lib/site_perl/5.26.1/x86_64-linux-gnu-thread-multi", 0x7ffe63a060c0) = -1 ENOENT (No such file or directory)
stat("/usr/local/lib/site_perl/5.26.1", 0x7ffe63a060c0) = -1 ENOENT (No such file or directory)
stat("/usr/local/lib/site_perl/x86_64-linux-gnu-thread-multi", 0x7ffe63a060c0) = -1 ENOENT (No such file or directory)
stat("/usr/local/lib/x86_64-linux-gnu/perl/5.26.0", 0x7ffe63a062f0) = -1 ENOENT (No such file or directory)
stat("/usr/local/share/perl/5.26.0", 0x7ffe63a062f0) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl-base/5.26.0", 0x7ffe63a060c0) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl-base/5.26.0/x86_64-linux-gnu-thread-multi", 0x7ffe63a060c0) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl-base/x86_64-linux-gnu-thread-multi", 0x7ffe63a060c0) = -1 ENOENT (No such file or directory)
ioctl(0, TCGETS, 0x7ffe63a05ea0) = -1 ENOTTY (Inappropriate ioctl for device)
lseek(0, 0, SEEK_CUR) = -1 ESPIPE (Illegal seek)
ioctl(1, TCGETS, 0x7ffe63a05ea0) = -1 ENOTTY (Inappropriate ioctl for device)
lseek(1, 0, SEEK_CUR) = -1 ESPIPE (Illegal seek)
ioctl(2, TCGETS, 0x7ffe63a05eb0) = -1 ENOTTY (Inappropriate ioctl for device)
lseek(2, 0, SEEK_CUR) = -1 ESPIPE (Illegal seek)
openat(AT_FDCWD, "/usr/bin/bowtie2", O_RDONLY) = 3
ioctl(3, TCGETS, 0x7ffe63a05fb0) = -1 ENOTTY (Inappropriate ioctl for device)
lseek(3, 0, SEEK_CUR) = 0
fcntl(3, F_SETFD, FD_CLOEXEC) = 0
fstat(3, {st_mode=S_IFREG|0755, st_size=19371, ...}) = 0
getuid() = 0
geteuid() = 0
getgid() = 0
getegid() = 0
rt_sigaction(SIGCHLD, NULL, {sa_handler=SIG_DFL, sa_mask=[], sa_flags=0}, 8) = 0
brk(0x557bfcd03000) = 0x557bfcd03000
read(3, "#!/usr/bin/env perl\n\n#\n# Copyrig"..., 8192) = 8192
stat("/etc/perl/strict.pmc", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/etc/perl/strict.pm", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/local/lib/x86_64-linux-gnu/perl/5.26.1/strict.pmc", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/local/lib/x86_64-linux-gnu/perl/5.26.1/strict.pm", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/local/share/perl/5.26.1/strict.pmc", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/local/share/perl/5.26.1/strict.pm", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl5/5.26/strict.pmc", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl5/5.26/strict.pm", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/share/perl5/strict.pmc", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/share/perl5/strict.pm", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl/5.26/strict.pmc", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl/5.26/strict.pm", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/share/perl/5.26/strict.pmc", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/share/perl/5.26/strict.pm", {st_mode=S_IFREG|0644, st_size=1606, ...}) = 0
openat(AT_FDCWD, "/usr/share/perl/5.26/strict.pm", O_RDONLY) = 4
ioctl(4, TCGETS, 0x7ffe63a05820) = -1 ENOTTY (Inappropriate ioctl for device)
lseek(4, 0, SEEK_CUR) = 0
read(4, "package strict;\n\n$strict::VERSIO"..., 8192) = 1606
lseek(4, 1605, SEEK_SET) = 1605
lseek(4, 0, SEEK_CUR) = 1605
close(4) = 0
stat("/etc/perl/warnings.pmc", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/etc/perl/warnings.pm", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/local/lib/x86_64-linux-gnu/perl/5.26.1/warnings.pmc", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/local/lib/x86_64-linux-gnu/perl/5.26.1/warnings.pm", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/local/share/perl/5.26.1/warnings.pmc", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/local/share/perl/5.26.1/warnings.pm", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl5/5.26/warnings.pmc", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl5/5.26/warnings.pm", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/share/perl5/warnings.pmc", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/share/perl5/warnings.pm", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl/5.26/warnings.pmc", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl/5.26/warnings.pm", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/share/perl/5.26/warnings.pmc", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/share/perl/5.26/warnings.pm", {st_mode=S_IFREG|0644, st_size=21950, ...}) = 0
openat(AT_FDCWD, "/usr/share/perl/5.26/warnings.pm", O_RDONLY) = 4
ioctl(4, TCGETS, 0x7ffe63a05820) = -1 ENOTTY (Inappropriate ioctl for device)
lseek(4, 0, SEEK_CUR) = 0
read(4, "# -- buffer-read-only: t --\n# "..., 8192) = 8192
brk(0x557bfcd24000) = 0x557bfcd24000
read(4, "# [38]\n 'severe'\t\t\t\t=> "\x00\"..., 8192) = 8192
read(4, "\x00\x00\x00\x00\x00\x00\x08\x00"..., 8192) = 5566
brk(0x557bfcd46000) = 0x557bfcd46000
lseek(4, 21870, SEEK_SET) = 21870
lseek(4, 0, SEEK_CUR) = 21870
close(4) = 0
stat("/etc/perl/Getopt/Long.pmc", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/etc/perl/Getopt/Long.pm", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/local/lib/x86_64-linux-gnu/perl/5.26.1/Getopt/Long.pmc", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/local/lib/x86_64-linux-gnu/perl/5.26.1/Getopt/Long.pm", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/local/share/perl/5.26.1/Getopt/Long.pmc", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/local/share/perl/5.26.1/Getopt/Long.pm", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl5/5.26/Getopt/Long.pmc", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl5/5.26/Getopt/Long.pm", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/share/perl5/Getopt/Long.pmc", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/share/perl5/Getopt/Long.pm", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl/5.26/Getopt/Long.pmc", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl/5.26/Getopt/Long.pm", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/share/perl/5.26/Getopt/Long.pmc", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/share/perl/5.26/Getopt/Long.pm", {st_mode=S_IFREG|0644, st_size=43325, ...}) = 0
openat(AT_FDCWD, "/usr/share/perl/5.26/Getopt/Long.pm", O_RDONLY) = 4
ioctl(4, TCGETS, 0x7ffe63a05820) = -1 ENOTTY (Inappropriate ioctl for device)
lseek(4, 0, SEEK_CUR) = 0
read(4, "#! perl\n\n# Getopt::Long.pm -- Un"..., 8192) = 8192
stat("/etc/perl/vars.pmc", 0x7ffe63a05370) = -1 ENOENT (No such file or directory)
stat("/etc/perl/vars.pm", 0x7ffe63a05370) = -1 ENOENT (No such file or directory)
stat("/usr/local/lib/x86_64-linux-gnu/perl/5.26.1/vars.pmc", 0x7ffe63a05370) = -1 ENOENT (No such file or directory)
stat("/usr/local/lib/x86_64-linux-gnu/perl/5.26.1/vars.pm", 0x7ffe63a05370) = -1 ENOENT (No such file or directory)
stat("/usr/local/share/perl/5.26.1/vars.pmc", 0x7ffe63a05370) = -1 ENOENT (No such file or directory)
stat("/usr/local/share/perl/5.26.1/vars.pm", 0x7ffe63a05370) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl5/5.26/vars.pmc", 0x7ffe63a05370) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl5/5.26/vars.pm", 0x7ffe63a05370) = -1 ENOENT (No such file or directory)
stat("/usr/share/perl5/vars.pmc", 0x7ffe63a05370) = -1 ENOENT (No such file or directory)
stat("/usr/share/perl5/vars.pm", 0x7ffe63a05370) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl/5.26/vars.pmc", 0x7ffe63a05370) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl/5.26/vars.pm", 0x7ffe63a05370) = -1 ENOENT (No such file or directory)
stat("/usr/share/perl/5.26/vars.pmc", 0x7ffe63a05370) = -1 ENOENT (No such file or directory)
stat("/usr/share/perl/5.26/vars.pm", {st_mode=S_IFREG|0644, st_size=1149, ...}) = 0
openat(AT_FDCWD, "/usr/share/perl/5.26/vars.pm", O_RDONLY) = 5
ioctl(5, TCGETS, 0x7ffe63a05120) = -1 ENOTTY (Inappropriate ioctl for device)
lseek(5, 0, SEEK_CUR) = 0
read(5, "package vars;\n\nuse 5.006;\n\nour $"..., 8192) = 1149
stat("/etc/perl/warnings/register.pmc", 0x7ffe63a04c70) = -1 ENOENT (No such file or directory)
stat("/etc/perl/warnings/register.pm", 0x7ffe63a04c70) = -1 ENOENT (No such file or directory)
stat("/usr/local/lib/x86_64-linux-gnu/perl/5.26.1/warnings/register.pmc", 0x7ffe63a04c70) = -1 ENOENT (No such file or directory)
stat("/usr/local/lib/x86_64-linux-gnu/perl/5.26.1/warnings/register.pm", 0x7ffe63a04c70) = -1 ENOENT (No such file or directory)
stat("/usr/local/share/perl/5.26.1/warnings/register.pmc", 0x7ffe63a04c70) = -1 ENOENT (No such file or directory)
stat("/usr/local/share/perl/5.26.1/warnings/register.pm", 0x7ffe63a04c70) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl5/5.26/warnings/register.pmc", 0x7ffe63a04c70) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl5/5.26/warnings/register.pm", 0x7ffe63a04c70) = -1 ENOENT (No such file or directory)
stat("/usr/share/perl5/warnings/register.pmc", 0x7ffe63a04c70) = -1 ENOENT (No such file or directory)
stat("/usr/share/perl5/warnings/register.pm", 0x7ffe63a04c70) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl/5.26/warnings/register.pmc", 0x7ffe63a04c70) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl/5.26/warnings/register.pm", 0x7ffe63a04c70) = -1 ENOENT (No such file or directory)
stat("/usr/share/perl/5.26/warnings/register.pmc", 0x7ffe63a04c70) = -1 ENOENT (No such file or directory)
stat("/usr/share/perl/5.26/warnings/register.pm", {st_mode=S_IFREG|0644, st_size=488, ...}) = 0
openat(AT_FDCWD, "/usr/share/perl/5.26/warnings/register.pm", O_RDONLY) = 6
ioctl(6, TCGETS, 0x7ffe63a04a20) = -1 ENOTTY (Inappropriate ioctl for device)
lseek(6, 0, SEEK_CUR) = 0
read(6, "package warnings::register;\n\nour"..., 8192) = 488
brk(0x557bfcd67000) = 0x557bfcd67000
lseek(6, 487, SEEK_SET) = 487
lseek(6, 0, SEEK_CUR) = 487
close(6) = 0
lseek(5, 1148, SEEK_SET) = 1148
lseek(5, 0, SEEK_CUR) = 1148
close(5) = 0
stat("/etc/perl/Exporter.pmc", 0x7ffe63a05370) = -1 ENOENT (No such file or directory)
stat("/etc/perl/Exporter.pm", 0x7ffe63a05370) = -1 ENOENT (No such file or directory)
stat("/usr/local/lib/x86_64-linux-gnu/perl/5.26.1/Exporter.pmc", 0x7ffe63a05370) = -1 ENOENT (No such file or directory)
stat("/usr/local/lib/x86_64-linux-gnu/perl/5.26.1/Exporter.pm", 0x7ffe63a05370) = -1 ENOENT (No such file or directory)
stat("/usr/local/share/perl/5.26.1/Exporter.pmc", 0x7ffe63a05370) = -1 ENOENT (No such file or directory)
stat("/usr/local/share/perl/5.26.1/Exporter.pm", 0x7ffe63a05370) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl5/5.26/Exporter.pmc", 0x7ffe63a05370) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl5/5.26/Exporter.pm", 0x7ffe63a05370) = -1 ENOENT (No such file or directory)
stat("/usr/share/perl5/Exporter.pmc", 0x7ffe63a05370) = -1 ENOENT (No such file or directory)
stat("/usr/share/perl5/Exporter.pm", 0x7ffe63a05370) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl/5.26/Exporter.pmc", 0x7ffe63a05370) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl/5.26/Exporter.pm", 0x7ffe63a05370) = -1 ENOENT (No such file or directory)
stat("/usr/share/perl/5.26/Exporter.pmc", 0x7ffe63a05370) = -1 ENOENT (No such file or directory)
stat("/usr/share/perl/5.26/Exporter.pm", {st_mode=S_IFREG|0644, st_size=2367, ...}) = 0
openat(AT_FDCWD, "/usr/share/perl/5.26/Exporter.pm", O_RDONLY) = 5
ioctl(5, TCGETS, 0x7ffe63a05120) = -1 ENOTTY (Inappropriate ioctl for device)
lseek(5, 0, SEEK_CUR) = 0
read(5, "package Exporter;\n\nrequire 5.006"..., 8192) = 2367
lseek(5, 2366, SEEK_SET) = 2366
lseek(5, 0, SEEK_CUR) = 2366
close(5) = 0
brk(0x557bfcd88000) = 0x557bfcd88000
stat("/etc/perl/constant.pmc", 0x7ffe63a05370) = -1 ENOENT (No such file or directory)
stat("/etc/perl/constant.pm", 0x7ffe63a05370) = -1 ENOENT (No such file or directory)
stat("/usr/local/lib/x86_64-linux-gnu/perl/5.26.1/constant.pmc", 0x7ffe63a05370) = -1 ENOENT (No such file or directory)
stat("/usr/local/lib/x86_64-linux-gnu/perl/5.26.1/constant.pm", 0x7ffe63a05370) = -1 ENOENT (No such file or directory)
stat("/usr/local/share/perl/5.26.1/constant.pmc", 0x7ffe63a05370) = -1 ENOENT (No such file or directory)
stat("/usr/local/share/perl/5.26.1/constant.pm", 0x7ffe63a05370) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl5/5.26/constant.pmc", 0x7ffe63a05370) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl5/5.26/constant.pm", 0x7ffe63a05370) = -1 ENOENT (No such file or directory)
stat("/usr/share/perl5/constant.pmc", 0x7ffe63a05370) = -1 ENOENT (No such file or directory)
stat("/usr/share/perl5/constant.pm", 0x7ffe63a05370) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl/5.26/constant.pmc", 0x7ffe63a05370) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl/5.26/constant.pm", 0x7ffe63a05370) = -1 ENOENT (No such file or directory)
stat("/usr/share/perl/5.26/constant.pmc", 0x7ffe63a05370) = -1 ENOENT (No such file or directory)
stat("/usr/share/perl/5.26/constant.pm", {st_mode=S_IFREG|0644, st_size=5737, ...}) = 0
openat(AT_FDCWD, "/usr/share/perl/5.26/constant.pm", O_RDONLY) = 5
ioctl(5, TCGETS, 0x7ffe63a05120) = -1 ENOTTY (Inappropriate ioctl for device)
lseek(5, 0, SEEK_CUR) = 0
read(5, "package constant;\nuse 5.008;\nuse"..., 8192) = 5737
brk(0x557bfcdac000) = 0x557bfcdac000
lseek(5, 5736, SEEK_SET) = 5736
lseek(5, 0, SEEK_CUR) = 5736
close(5) = 0
read(4, "= 0;\n\tprint STDERR\n\t ("Getopt::"..., 8192) = 8192
brk(0x557bfcdd0000) = 0x557bfcdd0000
read(4, "}) eq 'ARRAY' ) {\n\t\t\tprint STDER"..., 8192) = 8192
brk(0x557bfcdf1000) = 0x557bfcdf1000
read(4, " foreach ( @NAMEs ) {\n\n\t$_ = "..., 8192) = 8192
brk(0x557bfce13000) = 0x557bfce13000
read(4, "sh back.\n\t unshift (@$argv, $"..., 8192) = 8192
brk(0x557bfce37000) = 0x557bfce37000
brk(0x557bfce5b000) = 0x557bfce5b000
read(4, ""NOEXIT" || $pa->{-exitval} < 2)"..., 8192) = 2365
stat("/etc/perl/overload.pmc", 0x7ffe63a05370) = -1 ENOENT (No such file or directory)
stat("/etc/perl/overload.pm", 0x7ffe63a05370) = -1 ENOENT (No such file or directory)
stat("/usr/local/lib/x86_64-linux-gnu/perl/5.26.1/overload.pmc", 0x7ffe63a05370) = -1 ENOENT (No such file or directory)
stat("/usr/local/lib/x86_64-linux-gnu/perl/5.26.1/overload.pm", 0x7ffe63a05370) = -1 ENOENT (No such file or directory)
stat("/usr/local/share/perl/5.26.1/overload.pmc", 0x7ffe63a05370) = -1 ENOENT (No such file or directory)
stat("/usr/local/share/perl/5.26.1/overload.pm", 0x7ffe63a05370) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl5/5.26/overload.pmc", 0x7ffe63a05370) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl5/5.26/overload.pm", 0x7ffe63a05370) = -1 ENOENT (No such file or directory)
stat("/usr/share/perl5/overload.pmc", 0x7ffe63a05370) = -1 ENOENT (No such file or directory)
stat("/usr/share/perl5/overload.pm", 0x7ffe63a05370) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl/5.26/overload.pmc", 0x7ffe63a05370) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl/5.26/overload.pm", 0x7ffe63a05370) = -1 ENOENT (No such file or directory)
stat("/usr/share/perl/5.26/overload.pmc", 0x7ffe63a05370) = -1 ENOENT (No such file or directory)
stat("/usr/share/perl/5.26/overload.pm", {st_mode=S_IFREG|0644, st_size=4441, ...}) = 0
openat(AT_FDCWD, "/usr/share/perl/5.26/overload.pm", O_RDONLY) = 5
ioctl(5, TCGETS, 0x7ffe63a05120) = -1 ENOTTY (Inappropriate ioctl for device)
lseek(5, 0, SEEK_CUR) = 0
read(5, "package overload;\n\nour $VERSION "..., 8192) = 4441
brk(0x557bfce7c000) = 0x557bfce7c000
stat("/etc/perl/overloading.pmc", 0x7ffe63a04c70) = -1 ENOENT (No such file or directory)
stat("/etc/perl/overloading.pm", 0x7ffe63a04c70) = -1 ENOENT (No such file or directory)
stat("/usr/local/lib/x86_64-linux-gnu/perl/5.26.1/overloading.pmc", 0x7ffe63a04c70) = -1 ENOENT (No such file or directory)
stat("/usr/local/lib/x86_64-linux-gnu/perl/5.26.1/overloading.pm", 0x7ffe63a04c70) = -1 ENOENT (No such file or directory)
stat("/usr/local/share/perl/5.26.1/overloading.pmc", 0x7ffe63a04c70) = -1 ENOENT (No such file or directory)
stat("/usr/local/share/perl/5.26.1/overloading.pm", 0x7ffe63a04c70) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl5/5.26/overloading.pmc", 0x7ffe63a04c70) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl5/5.26/overloading.pm", 0x7ffe63a04c70) = -1 ENOENT (No such file or directory)
stat("/usr/share/perl5/overloading.pmc", 0x7ffe63a04c70) = -1 ENOENT (No such file or directory)
stat("/usr/share/perl5/overloading.pm", 0x7ffe63a04c70) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl/5.26/overloading.pmc", 0x7ffe63a04c70) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl/5.26/overloading.pm", 0x7ffe63a04c70) = -1 ENOENT (No such file or directory)
stat("/usr/share/perl/5.26/overloading.pmc", 0x7ffe63a04c70) = -1 ENOENT (No such file or directory)
stat("/usr/share/perl/5.26/overloading.pm", {st_mode=S_IFREG|0644, st_size=964, ...}) = 0
openat(AT_FDCWD, "/usr/share/perl/5.26/overloading.pm", O_RDONLY) = 6
ioctl(6, TCGETS, 0x7ffe63a04a20) = -1 ENOTTY (Inappropriate ioctl for device)
lseek(6, 0, SEEK_CUR) = 0
read(6, "package overloading;\nuse warning"..., 8192) = 964
lseek(6, 963, SEEK_SET) = 963
lseek(6, 0, SEEK_CUR) = 963
close(6) = 0
lseek(5, 4440, SEEK_SET) = 4440
lseek(5, 0, SEEK_CUR) = 4440
close(5) = 0
brk(0x557bfce9e000) = 0x557bfce9e000
read(4, "", 8192) = 0
close(4) = 0
getuid() = 0
geteuid() = 0
getgid() = 0
getegid() = 0
stat("/etc/perl/Exporter/Heavy.pmc", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/etc/perl/Exporter/Heavy.pm", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/local/lib/x86_64-linux-gnu/perl/5.26.1/Exporter/Heavy.pmc", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/local/lib/x86_64-linux-gnu/perl/5.26.1/Exporter/Heavy.pm", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/local/share/perl/5.26.1/Exporter/Heavy.pmc", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/local/share/perl/5.26.1/Exporter/Heavy.pm", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl5/5.26/Exporter/Heavy.pmc", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl5/5.26/Exporter/Heavy.pm", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/share/perl5/Exporter/Heavy.pmc", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/share/perl5/Exporter/Heavy.pm", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl/5.26/Exporter/Heavy.pmc", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl/5.26/Exporter/Heavy.pm", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/share/perl/5.26/Exporter/Heavy.pmc", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/share/perl/5.26/Exporter/Heavy.pm", {st_mode=S_IFREG|0644, st_size=6406, ...}) = 0
openat(AT_FDCWD, "/usr/share/perl/5.26/Exporter/Heavy.pm", O_RDONLY) = 4
ioctl(4, TCGETS, 0x7ffe63a05820) = -1 ENOTTY (Inappropriate ioctl for device)
lseek(4, 0, SEEK_CUR) = 0
read(4, "package Exporter::Heavy;\n\nuse st"..., 8192) = 6406
read(4, "", 8192) = 0
close(4) = 0
stat("/etc/perl/File/Spec.pmc", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/etc/perl/File/Spec.pm", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/local/lib/x86_64-linux-gnu/perl/5.26.1/File/Spec.pmc", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/local/lib/x86_64-linux-gnu/perl/5.26.1/File/Spec.pm", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/local/share/perl/5.26.1/File/Spec.pmc", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/local/share/perl/5.26.1/File/Spec.pm", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl5/5.26/File/Spec.pmc", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl5/5.26/File/Spec.pm", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/share/perl5/File/Spec.pmc", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/share/perl5/File/Spec.pm", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl/5.26/File/Spec.pmc", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl/5.26/File/Spec.pm", {st_mode=S_IFREG|0644, st_size=619, ...}) = 0
openat(AT_FDCWD, "/usr/lib/x86_64-linux-gnu/perl/5.26/File/Spec.pm", O_RDONLY) = 4
ioctl(4, TCGETS, 0x7ffe63a05820) = -1 ENOTTY (Inappropriate ioctl for device)
lseek(4, 0, SEEK_CUR) = 0
read(4, "package File::Spec;\n\nuse strict;"..., 8192) = 619
lseek(4, 618, SEEK_SET) = 618
lseek(4, 0, SEEK_CUR) = 618
close(4) = 0

stat("/etc/perl/File/Spec/Unix.pmc", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/etc/perl/File/Spec/Unix.pm", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/local/lib/x86_64-linux-gnu/perl/5.26.1/File/Spec/Unix.pmc", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/local/lib/x86_64-linux-gnu/perl/5.26.1/File/Spec/Unix.pm", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/local/share/perl/5.26.1/File/Spec/Unix.pmc", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/local/share/perl/5.26.1/File/Spec/Unix.pm", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl5/5.26/File/Spec/Unix.pmc", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl5/5.26/File/Spec/Unix.pm", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/share/perl5/File/Spec/Unix.pmc", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/share/perl5/File/Spec/Unix.pm", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl/5.26/File/Spec/Unix.pmc", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl/5.26/File/Spec/Unix.pm", {st_mode=S_IFREG|0644, st_size=10011, ...}) = 0
openat(AT_FDCWD, "/usr/lib/x86_64-linux-gnu/perl/5.26/File/Spec/Unix.pm", O_RDONLY) = 4
ioctl(4, TCGETS, 0x7ffe63a05820) = -1 ENOTTY (Inappropriate ioctl for device)
lseek(4, 0, SEEK_CUR) = 0
read(4, "package File::Spec::Unix;\n\nuse s"..., 8192) = 8192
brk(0x557bfcebf000) = 0x557bfcebf000
brk(0x557bfcee1000) = 0x557bfcee1000
read(4, "h\n if ( ! $self->file_name_is"..., 8192) = 1819
read(4, "", 8192) = 0
close(4) = 0
stat("/etc/perl/XSLoader.pmc", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/etc/perl/XSLoader.pm", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/local/lib/x86_64-linux-gnu/perl/5.26.1/XSLoader.pmc", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/local/lib/x86_64-linux-gnu/perl/5.26.1/XSLoader.pm", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/local/share/perl/5.26.1/XSLoader.pmc", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/local/share/perl/5.26.1/XSLoader.pm", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl5/5.26/XSLoader.pmc", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl5/5.26/XSLoader.pm", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/share/perl5/XSLoader.pmc", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/share/perl5/XSLoader.pm", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl/5.26/XSLoader.pmc", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl/5.26/XSLoader.pm", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/share/perl/5.26/XSLoader.pmc", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/share/perl/5.26/XSLoader.pm", {st_mode=S_IFREG|0644, st_size=3919, ...}) = 0
openat(AT_FDCWD, "/usr/share/perl/5.26/XSLoader.pm", O_RDONLY) = 4
ioctl(4, TCGETS, 0x7ffe63a05820) = -1 ENOTTY (Inappropriate ioctl for device)
lseek(4, 0, SEEK_CUR) = 0
read(4, "# Generated from XSLoader_pm.PL "..., 8192) = 3919
lseek(4, 3918, SEEK_SET) = 3918
lseek(4, 0, SEEK_CUR) = 3918
close(4) = 0
stat("/usr/lib/x86_64-linux-gnu/perl/5.26/auto/Cwd/Cwd.bs", 0x557bfccc14f0) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl/5.26/auto/Cwd/Cwd.so", {st_mode=S_IFREG|0644, st_size=14528, ...}) = 0
futex(0x7fe77dbf00c8, FUTEX_WAKE_PRIVATE, 2147483647) = 0
openat(AT_FDCWD, "/usr/lib/x86_64-linux-gnu/perl/5.26/auto/Cwd/Cwd.so", O_RDONLY|O_CLOEXEC) = 4
read(4, "\177ELF\2\1\1\0\0\0\0\0\0\0\0\0\3\0>\0\1\0\0\0\340\20\0\0\0\0\0\0"..., 832) = 832
fstat(4, {st_mode=S_IFREG|0644, st_size=14528, ...}) = 0
mmap(NULL, 2109776, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 4, 0) = 0x7fe77cc03000
mprotect(0x7fe77cc06000, 2093056, PROT_NONE) = 0
mmap(0x7fe77ce05000, 8192, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 4, 0x2000) = 0x7fe77ce05000
close(4) = 0
mprotect(0x7fe77ce05000, 4096, PROT_READ) = 0
getuid() = 0
geteuid() = 0
getgid() = 0
getegid() = 0
stat("/etc/perl/POSIX.pmc", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/etc/perl/POSIX.pm", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/local/lib/x86_64-linux-gnu/perl/5.26.1/POSIX.pmc", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/local/lib/x86_64-linux-gnu/perl/5.26.1/POSIX.pm", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/local/share/perl/5.26.1/POSIX.pmc", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/local/share/perl/5.26.1/POSIX.pm", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl5/5.26/POSIX.pmc", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl5/5.26/POSIX.pm", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/share/perl5/POSIX.pmc", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/share/perl5/POSIX.pm", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl/5.26/POSIX.pmc", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl/5.26/POSIX.pm", {st_mode=S_IFREG|0644, st_size=20198, ...}) = 0
openat(AT_FDCWD, "/usr/lib/x86_64-linux-gnu/perl/5.26/POSIX.pm", O_RDONLY) = 4
ioctl(4, TCGETS, 0x7ffe63a05820) = -1 ENOTTY (Inappropriate ioctl for device)
lseek(4, 0, SEEK_CUR) = 0
read(4, "package POSIX;\nuse strict;\nuse w"..., 8192) = 8192
stat("/etc/perl/Fcntl.pmc", 0x7ffe63a05370) = -1 ENOENT (No such file or directory)
stat("/etc/perl/Fcntl.pm", 0x7ffe63a05370) = -1 ENOENT (No such file or directory)
stat("/usr/local/lib/x86_64-linux-gnu/perl/5.26.1/Fcntl.pmc", 0x7ffe63a05370) = -1 ENOENT (No such file or directory)
stat("/usr/local/lib/x86_64-linux-gnu/perl/5.26.1/Fcntl.pm", 0x7ffe63a05370) = -1 ENOENT (No such file or directory)
stat("/usr/local/share/perl/5.26.1/Fcntl.pmc", 0x7ffe63a05370) = -1 ENOENT (No such file or directory)
stat("/usr/local/share/perl/5.26.1/Fcntl.pm", 0x7ffe63a05370) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl5/5.26/Fcntl.pmc", 0x7ffe63a05370) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl5/5.26/Fcntl.pm", 0x7ffe63a05370) = -1 ENOENT (No such file or directory)
stat("/usr/share/perl5/Fcntl.pmc", 0x7ffe63a05370) = -1 ENOENT (No such file or directory)
stat("/usr/share/perl5/Fcntl.pm", 0x7ffe63a05370) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl/5.26/Fcntl.pmc", 0x7ffe63a05370) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl/5.26/Fcntl.pm", {st_mode=S_IFREG|0644, st_size=2156, ...}) = 0
openat(AT_FDCWD, "/usr/lib/x86_64-linux-gnu/perl/5.26/Fcntl.pm", O_RDONLY) = 5
ioctl(5, TCGETS, 0x7ffe63a05120) = -1 ENOTTY (Inappropriate ioctl for device)
lseek(5, 0, SEEK_CUR) = 0
brk(0x557bfcf02000) = 0x557bfcf02000
read(5, "package Fcntl;\n\nuse strict;\nour("..., 8192) = 2156
read(5, "", 8192) = 0
close(5) = 0
getuid() = 0
geteuid() = 0
getgid() = 0
getegid() = 0
stat("/usr/lib/x86_64-linux-gnu/perl/5.26/auto/Fcntl/Fcntl.bs", 0x557bfccc14f0) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl/5.26/auto/Fcntl/Fcntl.so", {st_mode=S_IFREG|0644, st_size=18456, ...}) = 0
openat(AT_FDCWD, "/usr/lib/x86_64-linux-gnu/perl/5.26/auto/Fcntl/Fcntl.so", O_RDONLY|O_CLOEXEC) = 5
read(5, "\177ELF\2\1\1\0\0\0\0\0\0\0\0\0\3\0>\0\1\0\0\0\200\32\0\0\0\0\0\0"..., 832) = 832
fstat(5, {st_mode=S_IFREG|0644, st_size=18456, ...}) = 0
mmap(NULL, 2113784, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 5, 0) = 0x7fe77c9fe000
mprotect(0x7fe77ca01000, 2097152, PROT_NONE) = 0
mmap(0x7fe77cc01000, 8192, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 5, 0x3000) = 0x7fe77cc01000
close(5) = 0
mprotect(0x7fe77cc01000, 4096, PROT_READ) = 0
brk(0x557bfcf23000) = 0x557bfcf23000
read(4, " {\n usage "printf(pattern, ar"..., 8192) = 8192
brk(0x557bfcf45000) = 0x557bfcf45000
read(4, "payloadsig issignaling) ],\n\n "..., 8192) = 3814
brk(0x557bfcf66000) = 0x557bfcf66000
read(4, "", 8192) = 0
close(4) = 0
stat("/usr/lib/x86_64-linux-gnu/perl/5.26/auto/POSIX/POSIX.bs", 0x557bfccc14f0) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl/5.26/auto/POSIX/POSIX.so", {st_mode=S_IFREG|0644, st_size=105992, ...}) = 0
openat(AT_FDCWD, "/usr/lib/x86_64-linux-gnu/perl/5.26/auto/POSIX/POSIX.so", O_RDONLY|O_CLOEXEC) = 4
read(4, "\177ELF\2\1\1\0\0\0\0\0\0\0\0\0\3\0>\0\1\0\0\0\320i\0\0\0\0\0\0"..., 832) = 832
fstat(4, {st_mode=S_IFREG|0644, st_size=105992, ...}) = 0
mmap(NULL, 2201160, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 4, 0) = 0x7fe77c7e4000
mprotect(0x7fe77c7fa000, 2097152, PROT_NONE) = 0
mmap(0x7fe77c9fa000, 16384, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 4, 0x16000) = 0x7fe77c9fa000
close(4) = 0
mprotect(0x7fe77c9fa000, 12288, PROT_READ) = 0
brk(0x557bfcf87000) = 0x557bfcf87000
stat("/etc/perl/Tie/Hash.pmc", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/etc/perl/Tie/Hash.pm", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/local/lib/x86_64-linux-gnu/perl/5.26.1/Tie/Hash.pmc", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/local/lib/x86_64-linux-gnu/perl/5.26.1/Tie/Hash.pm", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/local/share/perl/5.26.1/Tie/Hash.pmc", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/local/share/perl/5.26.1/Tie/Hash.pm", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl5/5.26/Tie/Hash.pmc", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl5/5.26/Tie/Hash.pm", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/share/perl5/Tie/Hash.pmc", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/share/perl5/Tie/Hash.pm", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl/5.26/Tie/Hash.pmc", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl/5.26/Tie/Hash.pm", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/share/perl/5.26/Tie/Hash.pmc", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/share/perl/5.26/Tie/Hash.pm", {st_mode=S_IFREG|0644, st_size=2037, ...}) = 0
openat(AT_FDCWD, "/usr/share/perl/5.26/Tie/Hash.pm", O_RDONLY) = 4
ioctl(4, TCGETS, 0x7ffe63a05820) = -1 ENOTTY (Inappropriate ioctl for device)
lseek(4, 0, SEEK_CUR) = 0
read(4, "package Tie::Hash;\n\nour $VERSION"..., 8192) = 2037
stat("/etc/perl/Carp.pmc", 0x7ffe63a05370) = -1 ENOENT (No such file or directory)
stat("/etc/perl/Carp.pm", 0x7ffe63a05370) = -1 ENOENT (No such file or directory)
stat("/usr/local/lib/x86_64-linux-gnu/perl/5.26.1/Carp.pmc", 0x7ffe63a05370) = -1 ENOENT (No such file or directory)
stat("/usr/local/lib/x86_64-linux-gnu/perl/5.26.1/Carp.pm", 0x7ffe63a05370) = -1 ENOENT (No such file or directory)
stat("/usr/local/share/perl/5.26.1/Carp.pmc", 0x7ffe63a05370) = -1 ENOENT (No such file or directory)
stat("/usr/local/share/perl/5.26.1/Carp.pm", 0x7ffe63a05370) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl5/5.26/Carp.pmc", 0x7ffe63a05370) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl5/5.26/Carp.pm", 0x7ffe63a05370) = -1 ENOENT (No such file or directory)
stat("/usr/share/perl5/Carp.pmc", 0x7ffe63a05370) = -1 ENOENT (No such file or directory)
stat("/usr/share/perl5/Carp.pm", 0x7ffe63a05370) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl/5.26/Carp.pmc", 0x7ffe63a05370) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl/5.26/Carp.pm", 0x7ffe63a05370) = -1 ENOENT (No such file or directory)
stat("/usr/share/perl/5.26/Carp.pmc", 0x7ffe63a05370) = -1 ENOENT (No such file or directory)
stat("/usr/share/perl/5.26/Carp.pm", {st_mode=S_IFREG|0644, st_size=20148, ...}) = 0
openat(AT_FDCWD, "/usr/share/perl/5.26/Carp.pm", O_RDONLY) = 5
ioctl(5, TCGETS, 0x7ffe63a05120) = -1 ENOTTY (Inappropriate ioctl for device)
lseek(5, 0, SEEK_CUR) = 0
read(5, "package Carp;\n\n{ use 5.006; }\nus"..., 8192) = 8192
brk(0x557bfcfa8000) = 0x557bfcfa8000
brk(0x557bfcfa7000) = 0x557bfcfa7000
read(5, "} @Args;\n\n if ($overf"..., 8192) = 8192
brk(0x557bfcfca000) = 0x557bfcfca000
read(5, "d_msg = " thread $tid" if $tid;\n"..., 8192) = 3764
brk(0x557bfcfeb000) = 0x557bfcfeb000
lseek(5, 20147, SEEK_SET) = 20147
lseek(5, 0, SEEK_CUR) = 20147
close(5) = 0
getuid() = 0
geteuid() = 0
getgid() = 0
getegid() = 0
read(4, "", 8192) = 0
close(4) = 0
getuid() = 0
geteuid() = 0
getgid() = 0
getegid() = 0
brk(0x557bfd00c000) = 0x557bfd00c000
brk(0x557bfd02d000) = 0x557bfd02d000
stat("/etc/perl/Sys/Hostname.pmc", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/etc/perl/Sys/Hostname.pm", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/local/lib/x86_64-linux-gnu/perl/5.26.1/Sys/Hostname.pmc", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/local/lib/x86_64-linux-gnu/perl/5.26.1/Sys/Hostname.pm", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/local/share/perl/5.26.1/Sys/Hostname.pmc", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/local/share/perl/5.26.1/Sys/Hostname.pm", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl5/5.26/Sys/Hostname.pmc", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl5/5.26/Sys/Hostname.pm", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/share/perl5/Sys/Hostname.pmc", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/share/perl5/Sys/Hostname.pm", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl/5.26/Sys/Hostname.pmc", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl/5.26/Sys/Hostname.pm", {st_mode=S_IFREG|0644, st_size=3571, ...}) = 0
openat(AT_FDCWD, "/usr/lib/x86_64-linux-gnu/perl/5.26/Sys/Hostname.pm", O_RDONLY) = 4
ioctl(4, TCGETS, 0x7ffe63a05820) = -1 ENOTTY (Inappropriate ioctl for device)
lseek(4, 0, SEEK_CUR) = 0
read(4, "package Sys::Hostname;\n\nuse stri"..., 8192) = 3571
stat("/usr/lib/x86_64-linux-gnu/perl/5.26/auto/Sys/Hostname/Hostname.bs", 0x557bfccc14f0) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl/5.26/auto/Sys/Hostname/Hostname.so", {st_mode=S_IFREG|0644, st_size=6112, ...}) = 0
openat(AT_FDCWD, "/usr/lib/x86_64-linux-gnu/perl/5.26/auto/Sys/Hostname/Hostname.so", O_RDONLY|O_CLOEXEC) = 5
read(5, "\177ELF\2\1\1\0\0\0\0\0\0\0\0\0\3\0>\0\1\0\0\0\0\10\0\0\0\0\0\0"..., 832) = 832
fstat(5, {st_mode=S_IFREG|0644, st_size=6112, ...}) = 0
mmap(NULL, 2101360, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 5, 0) = 0x7fe77c5e2000
mprotect(0x7fe77c5e3000, 2093056, PROT_NONE) = 0
mmap(0x7fe77c7e2000, 8192, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 5, 0) = 0x7fe77c7e2000
close(5) = 0
mprotect(0x7fe77c7e2000, 4096, PROT_READ) = 0
lseek(4, 2894, SEEK_SET) = 2894
lseek(4, 0, SEEK_CUR) = 2894
close(4) = 0
getuid() = 0
geteuid() = 0
getgid() = 0
getegid() = 0
stat("/etc/perl/Config.pmc", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/etc/perl/Config.pm", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/local/lib/x86_64-linux-gnu/perl/5.26.1/Config.pmc", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/local/lib/x86_64-linux-gnu/perl/5.26.1/Config.pm", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/local/share/perl/5.26.1/Config.pmc", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/local/share/perl/5.26.1/Config.pm", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl5/5.26/Config.pmc", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl5/5.26/Config.pm", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/share/perl5/Config.pmc", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/share/perl5/Config.pm", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl/5.26/Config.pmc", 0x7ffe63a05a70) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl/5.26/Config.pm", {st_mode=S_IFREG|0644, st_size=3372, ...}) = 0
openat(AT_FDCWD, "/usr/lib/x86_64-linux-gnu/perl/5.26/Config.pm", O_RDONLY) = 4
ioctl(4, TCGETS, 0x7ffe63a05820) = -1 ENOTTY (Inappropriate ioctl for device)
lseek(4, 0, SEEK_CUR) = 0
read(4, "# This file was created by confi"..., 8192) = 3372
brk(0x557bfd04e000) = 0x557bfd04e000
read(4, "", 8192) = 0
close(4) = 0
read(3, "\n\t"log-file=s" "..., 8192) = 8192
brk(0x557bfd06f000) = 0x557bfd06f000
stat("/etc/perl/File/Glob.pmc", 0x7ffe63a058e0) = -1 ENOENT (No such file or directory)
stat("/etc/perl/File/Glob.pm", 0x7ffe63a058e0) = -1 ENOENT (No such file or directory)
stat("/usr/local/lib/x86_64-linux-gnu/perl/5.26.1/File/Glob.pmc", 0x7ffe63a058e0) = -1 ENOENT (No such file or directory)
stat("/usr/local/lib/x86_64-linux-gnu/perl/5.26.1/File/Glob.pm", 0x7ffe63a058e0) = -1 ENOENT (No such file or directory)
stat("/usr/local/share/perl/5.26.1/File/Glob.pmc", 0x7ffe63a058e0) = -1 ENOENT (No such file or directory)
stat("/usr/local/share/perl/5.26.1/File/Glob.pm", 0x7ffe63a058e0) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl5/5.26/File/Glob.pmc", 0x7ffe63a058e0) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl5/5.26/File/Glob.pm", 0x7ffe63a058e0) = -1 ENOENT (No such file or directory)
stat("/usr/share/perl5/File/Glob.pmc", 0x7ffe63a058e0) = -1 ENOENT (No such file or directory)
stat("/usr/share/perl5/File/Glob.pm", 0x7ffe63a058e0) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl/5.26/File/Glob.pmc", 0x7ffe63a058e0) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl/5.26/File/Glob.pm", {st_mode=S_IFREG|0644, st_size=2045, ...}) = 0
openat(AT_FDCWD, "/usr/lib/x86_64-linux-gnu/perl/5.26/File/Glob.pm", O_RDONLY) = 4
ioctl(4, TCGETS, 0x7ffe63a05690) = -1 ENOTTY (Inappropriate ioctl for device)
lseek(4, 0, SEEK_CUR) = 0
read(4, "package File::Glob;\n\nuse strict;"..., 8192) = 2045
lseek(4, 2044, SEEK_SET) = 2044
lseek(4, 0, SEEK_CUR) = 2044
close(4) = 0
getuid() = 0
geteuid() = 0
getgid() = 0
getegid() = 0
stat("/usr/lib/x86_64-linux-gnu/perl/5.26/auto/File/Glob/Glob.bs", 0x557bfccc14f0) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl/5.26/auto/File/Glob/Glob.so", {st_mode=S_IFREG|0644, st_size=27088, ...}) = 0
openat(AT_FDCWD, "/usr/lib/x86_64-linux-gnu/perl/5.26/auto/File/Glob/Glob.so", O_RDONLY|O_CLOEXEC) = 4
read(4, "\177ELF\2\1\1\0\0\0\0\0\0\0\0\0\3\0>\0\1\0\0\0\0\33\0\0\0\0\0\0"..., 832) = 832
fstat(4, {st_mode=S_IFREG|0644, st_size=27088, ...}) = 0
mmap(NULL, 2122256, PROT_READ|PROT_EXEC, MAP_PRIVATE|MAP_DENYWRITE, 4, 0) = 0x7fe77c3db000
mprotect(0x7fe77c3e1000, 2093056, PROT_NONE) = 0
mmap(0x7fe77c5e0000, 8192, PROT_READ|PROT_WRITE, MAP_PRIVATE|MAP_FIXED|MAP_DENYWRITE, 4, 0x5000) = 0x7fe77c5e0000
close(4) = 0
mprotect(0x7fe77c5e0000, 4096, PROT_READ) = 0
brk(0x557bfd092000) = 0x557bfd092000
read(3, "ot open --$i mate-1 output file "..., 8192) = 2987
read(3, "", 8192) = 0
close(3) = 0
brk(0x557bfd0b4000) = 0x557bfd0b4000
uname({sysname="Linux", nodename="ccd992e92b22", ...}) = 0
stat("/usr/bin/bowtie2", {st_mode=S_IFREG|0755, st_size=19371, ...}) = 0
lstat("/usr/bin/bowtie2", {st_mode=S_IFREG|0755, st_size=19371, ...}) = 0
stat("/etc/perl/Config_heavy.pl", 0x7ffe63a05c20) = -1 ENOENT (No such file or directory)
stat("/usr/local/lib/x86_64-linux-gnu/perl/5.26.1/Config_heavy.pl", 0x7ffe63a05c20) = -1 ENOENT (No such file or directory)
stat("/usr/local/share/perl/5.26.1/Config_heavy.pl", 0x7ffe63a05c20) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl5/5.26/Config_heavy.pl", 0x7ffe63a05c20) = -1 ENOENT (No such file or directory)
stat("/usr/share/perl5/Config_heavy.pl", 0x7ffe63a05c20) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl/5.26/Config_heavy.pl", {st_mode=S_IFREG|0644, st_size=54402, ...}) = 0
openat(AT_FDCWD, "/usr/lib/x86_64-linux-gnu/perl/5.26/Config_heavy.pl", O_RDONLY) = 3
ioctl(3, TCGETS, 0x7ffe63a059d0) = -1 ENOTTY (Inappropriate ioctl for device)
lseek(3, 0, SEEK_CUR) = 0
read(3, "# This file was created by confi"..., 8192) = 8192
read(3, "chlib=/usr/lib/x86_64-linux-gnu/"..., 8192) = 8192
read(3, " LONG_MAX=0x7fffffffffffffff"..., 8192) = 8192
read(3, "own='define'\nd_ldbl_dig='define'"..., 8192) = 8192
read(3, "/Perl/V Devel/SelfStubber Digest"..., 8192) = 8192
brk(0x557bfd0dd000) = 0x557bfd0dd000
brk(0x557bfd0d6000) = 0x557bfd0d6000
read(3, "-gnu /usr/lib/../lib /lib'\nlibs="..., 8192) = 8192
read(3, "ENTRANT_PROTO_B_IBW'\nstrings='/u"..., 8192) = 5250
read(3, "", 8192) = 0
close(3) = 0
brk(0x557bfd0fb000) = 0x557bfd0fb000
stat("/etc/perl/Config_git.pl", 0x7ffe63a05c10) = -1 ENOENT (No such file or directory)
stat("/usr/local/lib/x86_64-linux-gnu/perl/5.26.1/Config_git.pl", 0x7ffe63a05c10) = -1 ENOENT (No such file or directory)
stat("/usr/local/share/perl/5.26.1/Config_git.pl", 0x7ffe63a05c10) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl5/5.26/Config_git.pl", 0x7ffe63a05c10) = -1 ENOENT (No such file or directory)
stat("/usr/share/perl5/Config_git.pl", 0x7ffe63a05c10) = -1 ENOENT (No such file or directory)
stat("/usr/lib/x86_64-linux-gnu/perl/5.26/Config_git.pl", {st_mode=S_IFREG|0644, st_size=409, ...}) = 0
openat(AT_FDCWD, "/usr/lib/x86_64-linux-gnu/perl/5.26/Config_git.pl", O_RDONLY) = 3
ioctl(3, TCGETS, 0x7ffe63a059c0) = -1 ENOTTY (Inappropriate ioctl for device)
lseek(3, 0, SEEK_CUR) = 0
read(3, "################################"..., 8192) = 409
read(3, "", 8192) = 0
close(3) = 0
stat("/usr/bin/bowtie2-align-s", {st_mode=S_IFREG|0755, st_size=1616008, ...}) = 0
geteuid() = 0
pipe([3, 4]) = 0
pipe([5, 6]) = 0
clone(child_stack=NULL, flags=CLONE_CHILD_CLEARTID|CLONE_CHILD_SETTID|SIGCHLD, child_tidptr=0x7fe77de12290) = 7
close(6) = 0
close(4) = 0
read(5, "", 4) = 0
close(5) = 0
ioctl(3, TCGETS, 0x7ffe63a06130) = -1 ENOTTY (Inappropriate ioctl for device)
lseek(3, 0, SEEK_CUR) = -1 ESPIPE (Illegal seek)
fcntl(3, F_SETFD, FD_CLOEXEC) = 0
read(3, "verbose\t0\nstartverbose\t0\nquiet\t0"..., 8192) = 325
read(3, "maxins\t1\nquals\t1\nQ1\t1\nQ2\t1\nrefid"..., 8192) = 1891
read(3, "", 8192) = 0
--- SIGCHLD {si_signo=SIGCHLD, si_code=CLD_EXITED, si_pid=7, si_uid=0, si_status=0, si_utime=0, si_stime=1} ---
close(3) = 0
wait4(7, [{WIFEXITED(s) && WEXITSTATUS(s) == 0}], 0, NULL) = 7
openat(AT_FDCWD, ".", O_RDONLY|O_NONBLOCK|O_CLOEXEC|O_DIRECTORY) = 3
fstat(3, {st_mode=S_IFDIR|0755, st_size=4096, ...}) = 0
getdents(3, /* 26 entries /, 32768) = 1040
lstat("hg18.1.bt2", {st_mode=S_IFREG|0755, st_size=961172069, ...}) = 0
lstat("hg18.2.bt2", {st_mode=S_IFREG|0755, st_size=717656024, ...}) = 0
lstat("hg18.3.bt2", {st_mode=S_IFREG|0755, st_size=76850, ...}) = 0
lstat("hg18.4.bt2", {st_mode=S_IFREG|0755, st_size=717656019, ...}) = 0
lstat("hg18.rev.1.bt2", {st_mode=S_IFREG|0755, st_size=961172069, ...}) = 0
lstat("hg18.rev.2.bt2", {st_mode=S_IFREG|0755, st_size=717656024, ...}) = 0
getdents(3, / 0 entries /, 32768) = 0
close(3) = 0
openat(AT_FDCWD, ".", O_RDONLY|O_NONBLOCK|O_CLOEXEC|O_DIRECTORY) = 3
fstat(3, {st_mode=S_IFDIR|0755, st_size=4096, ...}) = 0
getdents(3, / 26 entries /, 32768) = 1040
getdents(3, / 0 entries */, 32768) = 0
close(3) = 0
stat("hg18.1.bt2l", 0x557bfccc14f0) = -1 ENOENT (No such file or directory)
pipe([3, 4]) = 0
rt_sigprocmask(SIG_BLOCK, [CHLD], [], 8) = 0
clone(child_stack=NULL, flags=CLONE_CHILD_CLEARTID|CLONE_CHILD_SETTID|SIGCHLD, child_tidptr=0x7fe77de12290) = 9
close(4) = 0
rt_sigaction(SIGINT, {sa_handler=SIG_IGN, sa_mask=[], sa_flags=SA_RESTORER, sa_restorer=0x7fe77d442890}, {sa_handler=SIG_DFL, sa_mask=[], sa_flags=0}, 8) = 0
rt_sigaction(SIGQUIT, {sa_handler=SIG_IGN, sa_mask=[], sa_flags=SA_RESTORER, sa_restorer=0x7fe77d442890}, {sa_handler=SIG_DFL, sa_mask=[], sa_flags=0}, 8) = 0
wait4(9, Killed
[{WIFEXITED(s) && WEXITSTATUS(s) == 137}], 0, NULL) = 9
rt_sigprocmask(SIG_SETMASK, [], NULL, 8) = 0
--- SIGCHLD {si_signo=SIGCHLD, si_code=CLD_EXITED, si_pid=9, si_uid=0, si_status=137, si_utime=0, si_stime=0} ---
rt_sigaction(SIGINT, {sa_handler=SIG_DFL, sa_mask=[], sa_flags=SA_RESTORER, sa_restorer=0x7fe77d442890}, NULL, 8) = 0
rt_sigaction(SIGQUIT, {sa_handler=SIG_DFL, sa_mask=[], sa_flags=SA_RESTORER, sa_restorer=0x7fe77d442890}, NULL, 8) = 0
read(3, "", 4) = 0
close(3) = 0
write(2, "(ERR): bowtie2-align exited with"..., 43(ERR): bowtie2-align exited with value 137
) = 43
rt_sigaction(SIGHUP, NULL, {sa_handler=SIG_DFL, sa_mask=[], sa_flags=0}, 8) = 0
rt_sigaction(SIGINT, NULL, {sa_handler=SIG_DFL, sa_mask=[], sa_flags=SA_RESTORER, sa_restorer=0x7fe77d442890}, 8) = 0
rt_sigaction(SIGQUIT, NULL, {sa_handler=SIG_DFL, sa_mask=[], sa_flags=SA_RESTORER, sa_restorer=0x7fe77d442890}, 8) = 0
rt_sigaction(SIGILL, NULL, {sa_handler=SIG_DFL, sa_mask=[], sa_flags=0}, 8) = 0
rt_sigaction(SIGTRAP, NULL, {sa_handler=SIG_DFL, sa_mask=[], sa_flags=0}, 8) = 0
rt_sigaction(SIGABRT, NULL, {sa_handler=SIG_DFL, sa_mask=[], sa_flags=0}, 8) = 0
rt_sigaction(SIGBUS, NULL, {sa_handler=SIG_DFL, sa_mask=[], sa_flags=0}, 8) = 0
rt_sigaction(SIGFPE, NULL, {sa_handler=SIG_IGN, sa_mask=[FPE], sa_flags=SA_RESTORER|SA_RESTART, sa_restorer=0x7fe77d07df20}, 8) = 0
rt_sigaction(SIGKILL, NULL, {sa_handler=SIG_DFL, sa_mask=[], sa_flags=0}, 8) = 0
rt_sigaction(SIGUSR1, NULL, {sa_handler=SIG_DFL, sa_mask=[], sa_flags=0}, 8) = 0
rt_sigaction(SIGSEGV, NULL, {sa_handler=SIG_DFL, sa_mask=[], sa_flags=0}, 8) = 0
rt_sigaction(SIGUSR2, NULL, {sa_handler=SIG_DFL, sa_mask=[], sa_flags=0}, 8) = 0
rt_sigaction(SIGPIPE, NULL, {sa_handler=SIG_DFL, sa_mask=[], sa_flags=0}, 8) = 0
rt_sigaction(SIGALRM, NULL, {sa_handler=SIG_DFL, sa_mask=[], sa_flags=0}, 8) = 0
rt_sigaction(SIGTERM, NULL, {sa_handler=SIG_DFL, sa_mask=[], sa_flags=0}, 8) = 0
rt_sigaction(SIGSTKFLT, NULL, {sa_handler=SIG_DFL, sa_mask=[], sa_flags=0}, 8) = 0
rt_sigaction(SIGCHLD, NULL, {sa_handler=SIG_DFL, sa_mask=[], sa_flags=0}, 8) = 0
rt_sigaction(SIGCONT, NULL, {sa_handler=SIG_DFL, sa_mask=[], sa_flags=0}, 8) = 0
rt_sigaction(SIGSTOP, NULL, {sa_handler=SIG_DFL, sa_mask=[], sa_flags=0}, 8) = 0
rt_sigaction(SIGTSTP, NULL, {sa_handler=SIG_DFL, sa_mask=[], sa_flags=0}, 8) = 0
rt_sigaction(SIGTTIN, NULL, {sa_handler=SIG_DFL, sa_mask=[], sa_flags=0}, 8) = 0
rt_sigaction(SIGTTOU, NULL, {sa_handler=SIG_DFL, sa_mask=[], sa_flags=0}, 8) = 0
rt_sigaction(SIGURG, NULL, {sa_handler=SIG_DFL, sa_mask=[], sa_flags=0}, 8) = 0
rt_sigaction(SIGXCPU, NULL, {sa_handler=SIG_DFL, sa_mask=[], sa_flags=0}, 8) = 0
rt_sigaction(SIGXFSZ, NULL, {sa_handler=SIG_DFL, sa_mask=[], sa_flags=0}, 8) = 0
rt_sigaction(SIGVTALRM, NULL, {sa_handler=SIG_DFL, sa_mask=[], sa_flags=0}, 8) = 0
rt_sigaction(SIGPROF, NULL, {sa_handler=SIG_DFL, sa_mask=[], sa_flags=0}, 8) = 0
rt_sigaction(SIGWINCH, NULL, {sa_handler=SIG_DFL, sa_mask=[], sa_flags=0}, 8) = 0
rt_sigaction(SIGIO, NULL, {sa_handler=SIG_DFL, sa_mask=[], sa_flags=0}, 8) = 0
rt_sigaction(SIGPWR, NULL, {sa_handler=SIG_DFL, sa_mask=[], sa_flags=0}, 8) = 0
rt_sigaction(SIGSYS, NULL, {sa_handler=SIG_DFL, sa_mask=[], sa_flags=0}, 8) = 0
rt_sigaction(SIGRT_2, NULL, {sa_handler=SIG_DFL, sa_mask=[], sa_flags=0}, 8) = 0
rt_sigaction(SIGRT_3, NULL, {sa_handler=SIG_DFL, sa_mask=[], sa_flags=0}, 8) = 0
rt_sigaction(SIGRT_4, NULL, {sa_handler=SIG_DFL, sa_mask=[], sa_flags=0}, 8) = 0
rt_sigaction(SIGRT_5, NULL, {sa_handler=SIG_DFL, sa_mask=[], sa_flags=0}, 8) = 0
rt_sigaction(SIGRT_6, NULL, {sa_handler=SIG_DFL, sa_mask=[], sa_flags=0}, 8) = 0
rt_sigaction(SIGRT_7, NULL, {sa_handler=SIG_DFL, sa_mask=[], sa_flags=0}, 8) = 0
rt_sigaction(SIGRT_8, NULL, {sa_handler=SIG_DFL, sa_mask=[], sa_flags=0}, 8) = 0
rt_sigaction(SIGRT_9, NULL, {sa_handler=SIG_DFL, sa_mask=[], sa_flags=0}, 8) = 0
rt_sigaction(SIGRT_10, NULL, {sa_handler=SIG_DFL, sa_mask=[], sa_flags=0}, 8) = 0
rt_sigaction(SIGRT_11, NULL, {sa_handler=SIG_DFL, sa_mask=[], sa_flags=0}, 8) = 0
rt_sigaction(SIGRT_12, NULL, {sa_handler=SIG_DFL, sa_mask=[], sa_flags=0}, 8) = 0
rt_sigaction(SIGRT_13, NULL, {sa_handler=SIG_DFL, sa_mask=[], sa_flags=0}, 8) = 0
rt_sigaction(SIGRT_14, NULL, {sa_handler=SIG_DFL, sa_mask=[], sa_flags=0}, 8) = 0
rt_sigaction(SIGRT_15, NULL, {sa_handler=SIG_DFL, sa_mask=[], sa_flags=0}, 8) = 0
rt_sigaction(SIGRT_16, NULL, {sa_handler=SIG_DFL, sa_mask=[], sa_flags=0}, 8) = 0
rt_sigaction(SIGRT_17, NULL, {sa_handler=SIG_DFL, sa_mask=[], sa_flags=0}, 8) = 0
rt_sigaction(SIGRT_18, NULL, {sa_handler=SIG_DFL, sa_mask=[], sa_flags=0}, 8) = 0
rt_sigaction(SIGRT_19, NULL, {sa_handler=SIG_DFL, sa_mask=[], sa_flags=0}, 8) = 0
rt_sigaction(SIGRT_20, NULL, {sa_handler=SIG_DFL, sa_mask=[], sa_flags=0}, 8) = 0
rt_sigaction(SIGRT_21, NULL, {sa_handler=SIG_DFL, sa_mask=[], sa_flags=0}, 8) = 0
rt_sigaction(SIGRT_22, NULL, {sa_handler=SIG_DFL, sa_mask=[], sa_flags=0}, 8) = 0
rt_sigaction(SIGRT_23, NULL, {sa_handler=SIG_DFL, sa_mask=[], sa_flags=0}, 8) = 0
rt_sigaction(SIGRT_24, NULL, {sa_handler=SIG_DFL, sa_mask=[], sa_flags=0}, 8) = 0
rt_sigaction(SIGRT_25, NULL, {sa_handler=SIG_DFL, sa_mask=[], sa_flags=0}, 8) = 0
rt_sigaction(SIGRT_26, NULL, {sa_handler=SIG_DFL, sa_mask=[], sa_flags=0}, 8) = 0
rt_sigaction(SIGRT_27, NULL, {sa_handler=SIG_DFL, sa_mask=[], sa_flags=0}, 8) = 0
rt_sigaction(SIGRT_28, NULL, {sa_handler=SIG_DFL, sa_mask=[], sa_flags=0}, 8) = 0
rt_sigaction(SIGRT_29, NULL, {sa_handler=SIG_DFL, sa_mask=[], sa_flags=0}, 8) = 0
rt_sigaction(SIGRT_30, NULL, {sa_handler=SIG_DFL, sa_mask=[], sa_flags=0}, 8) = 0
rt_sigaction(SIGRT_31, NULL, {sa_handler=SIG_DFL, sa_mask=[], sa_flags=0}, 8) = 0
rt_sigaction(SIGRT_32, NULL, {sa_handler=SIG_DFL, sa_mask=[], sa_flags=0}, 8) = 0
rt_sigaction(SIGABRT, NULL, {sa_handler=SIG_DFL, sa_mask=[], sa_flags=0}, 8) = 0
rt_sigaction(SIGCHLD, NULL, {sa_handler=SIG_DFL, sa_mask=[], sa_flags=0}, 8) = 0
rt_sigaction(SIGIO, NULL, {sa_handler=SIG_DFL, sa_mask=[], sa_flags=0}, 8) = 0
rt_sigaction(SIGSYS, NULL, {sa_handler=SIG_DFL, sa_mask=[], sa_flags=0}, 8) = 0
exit_group(137) = ?
+++ exited with 137 +++

Satırların birinde hg18.1.bt2l dosyası için sorgu yapıyor, ama bulamıyor. Bunun için mi öldürülüyor yoksa başka bir sorun mu var, tam kesin değil. .bt2l sorunu için önerilen çözüm bowtie2'nin eski sürümlerini (< v2.2.8) kullanmak.

Ama ben hala memory sorunundan şüpheleniyorum, Docker for Windows Hyper-V üzerinden çalıştığı için RAM'ın hepsini kullandırtmıyor diye belirten forum yazıları var.

İlk önce memory meselesini deneyelim: Docker'a 5gb memory kullanmasını söyleyelim

docker run --memory 5g --rm -v A:\Homosapiens:/data alperyilmaz/bowtie2-samtools bowtie2 -x hg18 -1 h.sapiens_seq_1.fastq -2 h.sapiens_seq_2.fastq -S output1.sam

docker run --memory 5g --rm -v A:\Homosapiens:/data alperyilmaz/bowtie2-samtools bowtie2 -
x hg18 -1 h.sapiens_seq_1.fastq -2 h.sapiens_seq_2.fastq -S output1.sam
Killed
(ERR): bowtie2-align exited with value 137