This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
git --git-dir /home/pvh/.planemo/gx_repo config remote.origin.fetch '+refs/*:refs/*' | |
git --git-dir /home/pvh/.planemo/gx_repo config remote.origin.mirror true | |
git --git-dir /home/pvh/.planemo/gx_repo remote update >/dev/null 2>&1 | |
git clone --branch master /home/pvh/.planemo/gx_repo /tmp/tmp4bznxpwc/galaxy-dev && cd /tmp/tmp4bznxpwc/galaxy-dev && if [ -d .venv ] || [ -f dist-eggs.ini ]; then GALAXY_VIRTUAL_ENV=.venv; else GALAXY_VIRTUAL_ENV=/home/pvh/.planemo/gx_venv; fi && export GALAXY_VIRTUAL_ENV && if [ ! -e "$GALAXY_VIRTUAL_ENV" ]; then /home/pvh/anaconda3/envs/planemo/bin/virtualenv -p /usr/bin/python2.7 $GALAXY_VIRTUAL_ENV; fi && if [ -e "$GALAXY_VIRTUAL_ENV" ]; then . "$GALAXY_VIRTUAL_ENV"/bin/activate; fi && COMMON_STARTUP_ARGS=; $(grep -q 'skip-venv' run_tests.sh) && COMMON_STARTUP_ARGS="--dev-wheels"; export COMMON_STARTUP_ARGS; echo "Set COMMON_STARTUP_ARGS to ${COMMON_STARTUP_ARGS}" && ./scripts/common_startup.sh ${COMMON_STARTUP_ARGS} | |
Cloning into '/tmp/tmp4bznxpwc/galaxy-dev'... | |
done. | |
Set COMMON |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
$ toil-cwl-runner --preserve-environment PATH --singularity ./example.cwl ./example-job.cwl | |
/usr/people/pvh/miniconda3/envs/toil/lib/python2.7/site-packages/cwltool/__init__.py:17: CWLToolDeprecationWarning: | |
DEPRECATION: Python 2.7 will reach the end of its life on January 1st, 2020. | |
Please upgrade your Python as the Python 2.7 version of cwltool won't be | |
maintained after that date. | |
""", category=CWLToolDeprecationWarning) | |
INFO:cwltool:Resolved './example.cwl' to 'file:///usr/people/pvh/toil/example.cwl' | |
WARNING:toil.batchSystems.singleMachine:Limiting maxCores to CPU count of system (24). | |
WARNING:toil.batchSystems.singleMachine:Limiting maxMemory to physically available memory (33714651136). |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
##fileformat=VCFv4.2 | |
##FILTER=<ID=PASS,Description="All filters passed"> | |
##fileDate=20191113 | |
##source=freeBayes v1.3.1-dirty | |
##reference=reference/ref.fa | |
##contig=<ID=Chromosome,length=4411532> | |
##phasing=none | |
##commandline="freebayes -p 2 -P 0 -C 10 --min-repeat-entropy 1.5 --strict-vcf -q 13 -m 60 --min-coverage 10 -F 0.05 -f reference/ref.fa snps.bam --region Chromosome:0-4411532" | |
##INFO=<ID=DP,Number=1,Type=Integer,Description="Total read depth at the locus"> | |
##INFO=<ID=RO,Number=1,Type=Integer,Description="Count of full observations of the reference haplotype."> |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
##fileformat=VCFv4.2 | |
##FILTER=<ID=PASS,Description="All filters passed"> | |
##fileDate=20191113 | |
##source=freeBayes v1.3.1-dirty | |
##reference=reference/ref.fa | |
##contig=<ID=Chromosome,length=4411532> | |
##phasing=none | |
##commandline="freebayes -p 2 -P 0 -C 10 --min-repeat-entropy 1.5 --strict-vcf -q 13 -m 60 --min-coverage 10 -F 0.05 -f reference/ref.fa snps.bam --region Chromosome:0-4411532" | |
##INFO=<ID=DP,Number=1,Type=Integer,Description="Total read depth at the locus"> | |
##INFO=<ID=RO,Number=1,Type=Integer,Description="Count of full observations of the reference haplotype."> |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
DEBUG conda.gateways.logging:set_verbosity(231): verbosity set to 2 | |
DEBUG conda.core.solve:solve_final_state(222): solving prefix /home/pvh/anaconda3/envs/rgi | |
specs_to_remove: frozenset() | |
specs_to_add: frozenset({MatchSpec("rgi")}) | |
prune: <auxlib._Null object at 0x7f64fad13ac8> | |
Collecting package metadata (current_repodata.json): ...working... DEBUG conda.core.package_cache_data:_check_writable(259): package cache directory '/home/pvh/anaconda3/pkgs' writable: True | |
DEBUG conda.core.package_cache_data:_check_writable(259): package cache directory '/home/pvh/anaconda3/pkgs' writable: True | |
DEBUG conda.core.package_cache_data:_check_writable(259): package cache directory '/home/pvh/anaconda3/pkgs' writable: True | |
DEBUG conda.core.package_cache_data:_check_writable(259): package cache directory '/home/pvh/anaconda3/pkgs' writable: True | |
DEBUG conda.core.package_cache_data:_check_writable(259): package cache directory '/home/pvh/anaconda3/pkgs' writable: True |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
DEBUG conda.gateways.logging:set_verbosity(231): verbosity set to 2 | |
DEBUG conda.core.solve:solve_final_state(222): solving prefix /home/pvh/anaconda3/envs/rgi | |
specs_to_remove: frozenset() | |
specs_to_add: frozenset({MatchSpec("rgi=5.1.0")}) | |
prune: <auxlib._Null object at 0x7f2630af0a20> | |
Collecting package metadata (current_repodata.json): ...working... DEBUG conda.core.package_cache_data:_check_writable(259): package cache directory '/home/pvh/anaconda3/pkgs' writable: True | |
DEBUG conda.core.package_cache_data:_check_writable(259): package cache directory '/home/pvh/anaconda3/pkgs' writable: True | |
DEBUG conda.core.package_cache_data:_check_writable(259): package cache directory '/home/pvh/anaconda3/pkgs' writable: True | |
DEBUG conda.core.package_cache_data:_check_writable(259): package cache directory '/home/pvh/anaconda3/pkgs' writable: True | |
DEBUG conda.core.package_cache_data:_check_writable(259): package cache directory '/home/pvh/anaconda3/pkgs' writable: True |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
(MTB_anc:0.0000404279,(ERR552627:0.0000095331,((ERR552650:0.0000037342,((((((((((((((ERR552714:0.0000016579,(ERR552408:0.0000008225,ERR552184:0.0000007560)93:0.000000231)90:0.000000696,(((ERR553080:0.0000045365,((ERR552633:0.0000026571,(ERR552243:0.0000018134,ERR553326:0.0000013601)100:0.000001425)95:0.000000683,ERR551209:0.0000031228)98:0.000000753)96:0.000001007,ERR552360:0.0000014937)84:0.000000755,ERR552967:0.0000011968)97:0.000001811)80:0.000000301,ERR552867:0.0000028514)85:0.000000749,ERR552368:0.0000020435)92:0.000000933,(((((((ERR551425:0.0000015400,(((ERR553305:0.0000015318,((ERR550804:0.0000020422,ERR552380:0.0000002294)86:0.000000694,ERR551517:0.0000015567)69:0.000000289)87:0.000000458,ERR551049:0.0000013181)91:0.000000926,ERR553279:0.0000002522)80:0.000000440)75:0.000000492,(((((ERR553288:0.0000011334,ERR551021:0.0000009067)98:0.000000774,((((((((((ERR552854:0.0000005301,ERR550691:0.0000019543)98:0.000000680,ERR552629:0.0000017437)100:0.000001673,(ERR553115:0.0000011389,(ERR551913:0.0000004540,E |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
>MTB_anc foo | |
CCCCGGGAGCCCGGTAGGCCGTCGGATGCGTCCCGCCCGGCGCGCCGTCCGCCACTCGGT | |
CGCACGCCCGGCCGGCCCCTAATGTTCGGCCACACCGAGCGGGCGAGAGGGGTGACTCGG | |
AGTCCCGGAGGCCGCCCCGGCCGAGTGCGTCGCCCACGCCGCGGCTTCCATGTGACATGC | |
TGGCCGAGCAGACAGAAGACGGGACGATCGCCCTCACGCGCGGGGGACCCGTGTGCAGGT | |
CCGGGGCCCGCAAGGCGACATGCCAACGGGCTTACACCCAATCTCCGCTGCTGTCCGCCA | |
ACACACGGTATTCCCCGGCGCGCCAGCCACGGGCTCTGGAGAACACCCATGACGGGGCGC | |
CCCGGCGCCCCCCCACGGAGAGGTACCGCCGCGGGAGCTCAGGGGGGCAGTTCTGGCCCT | |
ACGGAGGGCGGCTGTAGCCCGCCCTCTGCCCGAGCGGAGTCTCGGGGGCGGCGGGGACCT | |
CCGGATGCGTCTCTGAGGAGGTCTCGCGCCGCGTAGTTTGGTCTCAGCGCGACTGCGCCC |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
#!/usr/bin/env cwl-runner | |
cwlVersion: v1.0 | |
class: CommandLineTool | |
id: kraken2 | |
baseCommand: | |
- kraken2 | |
inputs: | |
database: | |
type: | |
- Directory |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
library(tidyverse) | |
surveys <- read_csv("data_raw/portal_data_joined.csv") | |
str(surveys) | |
select(surveys, plot_id, species_id, weight) | |
select(surveys, -record_id, -species_id) | |
filter(surveys, year == 1995) | |
surveys2 <- filter(surveys, weight < 5) |