Skip to content

Instantly share code, notes, and snippets.

View upendrak's full-sized avatar

Upendra Kumar Devisetty upendrak

52 followers · 35 following
View GitHub Profile
@jdblischak
jdblischak / hgen-473-rna-seq.R
Last active September 6, 2022 15:34
RNA-seq analysis with R/Bioconductor
# HGEN 473 - Genomics
# Spring 2017
# Tuesday, May 9 & Thursday, May 11
#
# RNA-seq analysis with R/Bioconductor
#
# John Blischak
#
# Last updated: 2020-04-08
@upkarlidder
upkarlidder / dl-resources.md
Last active June 18, 2022 08:32
Deep Learning Hands-On Series with Eric Schles
@crawles
crawles / Spark Dataframe Cheat Sheet.py
Last active April 26, 2022 03:09 — forked from evenv/Spark Dataframe Cheat Sheet.py
Cheat sheet for Spark Dataframes (using Python)
# A simple cheat sheet of Spark Dataframe syntax
# Current for Spark 1.6.1
# import statements
from pyspark.sql import SQLContext
from pyspark.sql.types import *
from pyspark.sql.functions import *
#creating dataframes
df = sqlContext.createDataFrame([(1, 4), (2, 5), (3, 6)], ["A", "B"]) # from manual data
@naomiajacobs
naomiajacobs / optimization.py
Last active January 1, 2021 16:45
bnt162b2 Vaccine Codon Optimization
from dnachisel import *
# Subbed in `CCTCCT` for `AAAGTT` to account for proline substitution
virus = 'ATGTTTGTTTTTCTTGTTTTATTGCCACTAGTCTCTAGTCAGTGTGTTAATCTTACAACCAGAACTCAATTACCCCCTGCATACACTAATTCTTTCACACGTGGTGTTTATTACCCTGACAAAGTTTTCAGATCCTCAGTTTTACATTCAACTCAGGACTTGTTCTTACCTTTCTTTTCCAATGTTACTTGGTTCCATGCTATACATGTCTCTGGGACCAATGGTACTAAGAGGTTTGATAACCCTGTCCTACCATTTAATGATGGTGTTTATTTTGCTTCCACTGAGAAGTCTAACATAATAAGAGGCTGGATTTTTGGTACTACTTTAGATTCGAAGACCCAGTCCCTACTTATTGTTAATAACGCTACTAATGTTGTTATTAAAGTCTGTGAATTTCAATTTTGTAATGATCCATTTTTGGGTGTTTATTACCACAAAAACAACAAAAGTTGGATGGAAAGTGAGTTCAGAGTTTATTCTAGTGCGAATAATTGCACTTTTGAATATGTCTCTCAGCCTTTTCTTATGGACCTTGAAGGAAAACAGGGTAATTTCAAAAATCTTAGGGAATTTGTGTTTAAGAATATTGATGGTTATTTTAAAATATATTCTAAGCACACGCCTATTAATTTAGTGCGTGATCTCCCTCAGGGTTTTTCGGCTTTAGAACCATTGGTAGATTTGCCAATAGGTATTAACATCACTAGGTTTCAAACTTTACTTGCTTTACATAGAAGTTATTTGACTCCTGGTGATTCTTCTTCAGGTTGGACAGCTGGTGCTGCAGCTTATTATGTGGGTTATCTTCAACCTAGGACTTTTCTATTAAAATATAATGAAAATGGAACCATTACAGATGCTGTAGACTGTGCACTTGACCCTCTCTCAGAAACAAAGTGTACGTTGAAATCCTTCAC
@rccordell
rccordell / renderSite.R
Last active September 8, 2020 00:42
This script builds on Aleszu Bajak's excellent [tutorial on building a course website using R Markdown and Github pages](http://www.storybench.org/convert-google-doc-rmarkdown-publish-github-pages/). It automates the rendering of HTML files from RMD and automatically generates the page menu for the site, eliminating much duplicative work.
# This script builds on Aleszu Bajak's excellent
# [tutorial on building a course website using R Markdown and Github pages](http://www.storybench.org/convert-google-doc-rmarkdown-publish-github-pages/).
# I was excited about the concept but wanted to automate a few of the production steps: namely generating the HTML files
# for the site from the RMD pages (which Aleszu describes doing one-by-one) and generating the site navigation menu,
# which Aleszu handcodes in the `_site.yml` file. This script should automate both processes, though it may have some quirks
# unique to my setup that you'd want to tweak to fit your own. It's likely more loquacious than necessary as well, so feel free
# to condense as you can. Ideally, each time you make updates to your RMD files you can run this script to generate updated HTML
# pages and a new `_site.yml`. Then commit changes to Github and you're up and running!
# Once you've got everything configured for your own site below, you should be able to run `source('rend
@leonawicz
leonawicz / bst.R
Last active September 7, 2020 02:14
Basic Bootrap Tour R wrapper example
# Bootstrap tour step
.bsTourStep <- function(i, id, title, content, pos = "right", tab = NULL){
id <- paste0("#", id)
x <- paste0(" {\n element: \"", id,
"\",\n title: \"", title,
"\",\n content: \"", content,
"\",\n placement: \"", pos, "\"")
if(i==1 && !is.null(tab)){
x <- paste0(x, ",\n onShow: function (tour) { $(\"", tab, "\").tab('show');}\n }")
} else {
@toniher
toniher / docker2singularity.sh
Last active February 2, 2020 07:52
Bash script wrapper for generating a singularity image from a local Docker image
#!/bin/bash
# Based on https://github.com/sylabs/singularity/issues/1537
# Usage: bash docker2singularity.sh mydockerimg mysingularity.simg
set -ueo pipefail
IMG=$1
FILEOUT=$2
PORT=${3:-5000}
@ldong
ldong / md_to_rst.sh
Last active August 18, 2019 18:26 — forked from hugorodgerbrown/md_to_rst.sh
convert markdown to rst files
# This script was created to convert a directory full
# of markdown files into rst equivalents. It uses
# pandoc to do the conversion.
#
# 1. Install pandoc from http://johnmacfarlane.net/pandoc/
# 2. Copy this script into the directory containing the .md files
# 3. Ensure that the script has execute permissions
# 4. Run the script
#
# By default this will keep the original .md file
@hiraksarkar
hiraksarkar / extract_transcript_intron.sh
Last active December 14, 2018 21:53
3 line script to extract intron boundaries per transcript
## requirement bed tools
BIN='/home/hirak/bedtools2/bin'
## Gencode
## gencode.v29.chr_patch_hapl_scaff.annotation.gtf
GTF_FILE="gencode.v29.chr_patch_hapl_scaff.annotation.gtf"
# extract transcript boundaries
cat $GTF_FILE | awk 'BEGIN{OFS="\t";} $3=="transcript" {print $1,$4-1,$5,$12}' | tr -d "\"" | tr -d ";" | $BIN/sortBed > gencode_transcript_intervals.bed
# merge exon boundaris
@ColinFay
ColinFay / shiny module snippet
Created June 5, 2018 12:40
snippet module
${1:name}UI <- function(id){
ns <- NS(id)
tagList(
)
}
${1:name} <- function(input, output, session){